Dataset for CDS BCL-2-like of organism Microcebus murinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8B7H1C6_BCL2-01      atggcgcacgctgggagaacaggg------tatgataaccgggagata--
A0A8C5XEX1_BCL2L10      atgg-gcgacct--------gttcagggagcgcacggagcggctgctg--
A0A8C5VC33_MCL1-01      ----------------------------------------ctct------
A0A8B7GKA0_MCL1-01      atgt-ttggcctcaaaagaaacgcggtaatcggactcaacctctactgtg
A0A8B7GKA0_MCL1-02      atgt-ttggcctcaaaagaaacgcggtaatcggactcaacctctactgtg
A0A8B7GKA0_MCL1-03      atgt-ttggcctcaaaagaaacgcggtaatcggactcaacctctactgtg
A0A8C5VB12_BCL2A1-      atgaagcagctccagaccctgctc------cccgccgggcggaagatg--
A0A8B7FNN3_BCL2L1-      atg--tc----------------t------cagagcaaccgggagctg--
A0A8B7FNN3_BCL2L1-      atg--tc----------------t------cagagcaaccgggagctg--
A0A8B7FNN3_BCL2L1-      atg--tc----------------t------cagagcaaccgggagctg--
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      atg--gcggcggcggcggcggcgg------cagcagcagcgggggctg--
A0A8B7FJ73_BCL2L2-      atg--gcggcggcggcggcggcgg------cagcagcagcgggggctg--
A0A8B7FJ73_BCL2L2-      atg--gcgaccccagcctcagccc------cagacaca-cgggctctg--
A0A8B7FJ73_BCL2L2-      atg--gcgaccccagcctcagccc------cagacaca-cgggctctg--

A0A8B7H1C6_BCL2-01      --gtgatgaagtacatccactataag------------------------
A0A8C5XEX1_BCL2L10      --gccgactacctggagtactgcgcc------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      gaggggccggattgggggccggcagc------------------------
A0A8B7GKA0_MCL1-02      gaggggccggattgggggccggcagc------------------------
A0A8B7GKA0_MCL1-03      gaggggccggattgggggccggcagc------------------------
A0A8C5VB12_BCL2A1-      --acgg------------gctgcgag------------------------
A0A8B7FNN3_BCL2L1-      --gtggttgactttctctcctacaagctttcccagaaaggatacagctgg
A0A8B7FNN3_BCL2L1-      --gtggttgactttctctcctacaagctttcccagaaaggatacagctgg
A0A8B7FNN3_BCL2L1-      --gtggttgactttctctcctacaagctttcccagaaaggatacagctgg
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --cgggcggtc----ggggctccggg------------------------
A0A8B7FJ73_BCL2L2-      --cgggcggtc----ggggctccggg------------------------
A0A8B7FJ73_BCL2L2-      --gtggcagactttgtaggctataag------------------------
A0A8B7FJ73_BCL2L2-      --gtggcagactttgtaggctataag------------------------

A0A8B7H1C6_BCL2-01      -----------------------ctgtcgcagaggggctacgagtgggat
A0A8C5XEX1_BCL2L10      ------------------------agggagccgggcaccccgg------g
A0A8C5VC33_MCL1-01      -----------------------------------------------gtg
A0A8B7GKA0_MCL1-01      ------------------------agcggcgccacccccccgggagggcg
A0A8B7GKA0_MCL1-02      ------------------------agcggcgccacccccccgggagggcg
A0A8B7GKA0_MCL1-03      ------------------------agcggcgccacccccccgggagggcg
A0A8C5VB12_BCL2A1-      --------ttcgaattcacccgagagctggcccaggactacctgcagcat
A0A8B7FNN3_BCL2L1-      agtcagtttattgatgcagaagaaaataggactgaggccccagaaggg--
A0A8B7FNN3_BCL2L1-      agtcagtttattgatgcagaagaaaataggactgaggccccagaaggg--
A0A8B7FNN3_BCL2L1-      agtcagtttattgatgcagaagaaaataggactgaggccccagaaggg--
A0A8B7FNN3_BCL2L1-      -------------atgcagaagaaaataggactgaggccccagaaggg--
A0A8B7FJ73_BCL2L2-      -------------------------------ccggggc----ggcggc--
A0A8B7FJ73_BCL2L2-      -------------------------------ccggggc----ggcggc--
A0A8B7FJ73_BCL2L2-      -------------------------------ctgaggc----agaaag--
A0A8B7FJ73_BCL2L2-      -------------------------------ctgaggc----agaaag--

A0A8B7H1C6_BCL2-01      gctggagaag----------------------------------------
A0A8C5XEX1_BCL2L10      gctgccgccgtcctcgctggaggcggccgcgctgcg--------------
A0A8C5VC33_MCL1-01      tcttatatct----------------------------------------
A0A8B7GKA0_MCL1-01      gcttttggctgccgagaaggaggccactgcccggcgagaggtagggggag
A0A8B7GKA0_MCL1-02      gcttttggctgccgagaaggaggccactgcccggcgagaggtagggggag
A0A8B7GKA0_MCL1-03      gctttt--------------------------------------------
A0A8C5VB12_BCL2A1-      gtcctg--------------------------------------------
A0A8B7FNN3_BCL2L1-      actgaa--------------------------------------------
A0A8B7FNN3_BCL2L1-      actgaa--------------------------------------------
A0A8B7FNN3_BCL2L1-      actgaa--------------------------------------------
A0A8B7FNN3_BCL2L1-      actgaa--------------------------------------------
A0A8B7FJ73_BCL2L2-      gccatc--------------------------------------------
A0A8B7FJ73_BCL2L2-      gccatc--------------------------------------------
A0A8B7FJ73_BCL2L2-      gttatg--------------------------------------------
A0A8B7FJ73_BCL2L2-      gttatg--------------------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      gggaagccggcacggtgattggcggaagccccggcgcaagccccccggcc
A0A8B7GKA0_MCL1-02      gggaagccggcacggtgattggcggaagccccggcgcaagccccccggcc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      tccctcacgccagacgcccggagggtcgcgcggccggcgcccattggtgc
A0A8B7GKA0_MCL1-02      tccctcacgccagacgcccggagggtcgcgcggccggcgcccattggtgc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      ------cctcgcagccaccaagattcggcagaagcacgcgtctttcttct
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      cgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgc
A0A8B7GKA0_MCL1-02      cgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      cggcctac------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      ccacccgccgcgcggtgccgcctgaggagatggaagcccctgccgccgac
A0A8B7GKA0_MCL1-02      ccacccgccgcgcggtgccgcctgaggagatggaagcccctgccgccgac
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      gccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctct
A0A8B7GKA0_MCL1-02      gccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctct
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      cgggaagcggccggctgtcctgcctttgctggagttggtcggggaggcca
A0A8B7GKA0_MCL1-02      cgggaagcggccggctgtcctgcctttgctggagttggtcggggaggcca
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------cgagcgctgcgcccccgg
A0A8C5XEX1_BCL2L10      ---------------------gtgggctacccggggaaccgcgtctccct
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      gtaatggctccggcacggaagggtcactaccctcgacgccgcccccagca
A0A8B7GKA0_MCL1-02      gtaatggctccggcacggaagggtcactaccctcgacgccgcccccagca
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------cgggcgccgcagccc---
A0A8B7FNN3_BCL2L1-      --------------------------------tcggagatggagaccccc
A0A8B7FNN3_BCL2L1-      --------------------------------tcggagatggagaccccc
A0A8B7FNN3_BCL2L1-      --------------------------------tcggagatggagaccccc
A0A8B7FNN3_BCL2L1-      --------------------------------tcggagatggagaccccc
A0A8B7FJ73_BCL2L2-      --------------------------------t-tgtgcccggggccggt
A0A8B7FJ73_BCL2L2-      --------------------------------t-tgtgcccggggccggt
A0A8B7FJ73_BCL2L2-      --------------------------------tctgtggagctggcccag
A0A8B7FJ73_BCL2L2-      --------------------------------tctgtggagctggcccag

A0A8B7H1C6_BCL2-01      gggccgtccccgcacctggcatcttctcttcccagcccgggggcaccccc
A0A8C5XEX1_BCL2L10      gatgg-----agcggatggc------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      gagga-----ggaggaggacgagttgtaccggcagtcgctggagattatc
A0A8B7GKA0_MCL1-02      gagga-----ggaggaggacgagttgtaccggcagtcgctggagattatc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      gggtc-----cagccccagcgaggcgtccc--------------------
A0A8B7FNN3_BCL2L1-      agtgc-----cattaatggcaacccatcctggcacctggcggacagcccc
A0A8B7FNN3_BCL2L1-      agtgc-----cattaatggcaacccatcctggcacctggcggacagcccc
A0A8B7FNN3_BCL2L1-      agtgc-----cattaatggcaacccatcctggcacctggcggacagcccc
A0A8B7FNN3_BCL2L1-      agtgc-----cattaatggcaacccatcct--------------------
A0A8B7FJ73_BCL2L2-      gg------------------------------------------------
A0A8B7FJ73_BCL2L2-      gg------------------------------------------------
A0A8B7FJ73_BCL2L2-      gg------------------------------------------------
A0A8B7FJ73_BCL2L2-      gg------------------------------------------------

A0A8B7H1C6_BCL2-01      cct-------------------cccgctgcgcctcgggacccggccgcca
A0A8C5XEX1_BCL2L10      -----------------------------------ggaggccgtgctctc
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      tctcggtaccttcgggagcaggcaaccggcgccaaggacgcaaagccaat
A0A8B7GKA0_MCL1-02      tctcggtaccttcgggagcaggcaaccggcgccaaggacgcaaagccaat
A0A8B7GKA0_MCL1-03      --------------------ggcaaccggcgccaaggacgcaaagccaat
A0A8C5VB12_BCL2A1-      -----------------------------------gggtgctgcggagcg
A0A8B7FNN3_BCL2L1-      ccagtgaatggagccactggccacagcagcagtttggatgcccgggaggt
A0A8B7FNN3_BCL2L1-      ccagtgaatggagccactggccacagcagcagtttggatgcccgggaggt
A0A8B7FNN3_BCL2L1-      ccagtgaatggagccactggccacagcagcagtttggatgcccgggaggt
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      -----------------------------------ggaggccggggaggg
A0A8B7FJ73_BCL2L2-      -----------------------------------ggaggccggggaggg
A0A8B7FJ73_BCL2L2-      -----------------------------------gagggcccagcagct
A0A8B7FJ73_BCL2L2-      -----------------------------------gagggcccagcagct

A0A8B7H1C6_BCL2-01      ggacctc-----------gcccccggccgcccacgccgctgccgcggggc
A0A8C5XEX1_BCL2L10      cgacagc--------------ctcagctggggccgc--gtggtgatgctc
A0A8C5VC33_MCL1-01      ---cagt--------------t----gtggg---------aaaaaggatc
A0A8B7GKA0_MCL1-01      gggcagg--------------t----ctggggccgccagcaggaaggcgc
A0A8B7GKA0_MCL1-02      gggcagg--------------t----ctggggccgccagcaggaaggcgc
A0A8B7GKA0_MCL1-03      gggcagg--------------t----ctggggccgccagcaggaaggcgc
A0A8C5VB12_BCL2A1-      tggcctc--------------ctccgtccaaaacgaagtggaaaggagac
A0A8B7FNN3_BCL2L1-      gatccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagt
A0A8B7FNN3_BCL2L1-      gatccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagt
A0A8B7FNN3_BCL2L1-      gatccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagt
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      ggccc--------------------------cggggggc-gcaggggact
A0A8B7FJ73_BCL2L2-      ggccc--------------------------cggggggc-gcaggggact
A0A8B7FJ73_BCL2L2-      gacccgc----------tgcaccaagccatgcgggcagctggagatgagt
A0A8B7FJ73_BCL2L2-      gacccgc----------tgcaccaagccatgcgggcagctggagatgagt

A0A8B7H1C6_BCL2-01      ctgcgctcagcc--------------------cagtgccacctgtggtcc
A0A8C5XEX1_BCL2L10      ctga----------------------------------------------
A0A8C5VC33_MCL1-01      -----------ccatgtgtt------------------------------
A0A8B7GKA0_MCL1-01      tagagaccttacgacgtgtcggggacggtgtgcagcgcaaccatcagacg
A0A8B7GKA0_MCL1-02      tagagaccttacgacgtgtcggggacggtgtgcagcgcaaccatcagacg
A0A8B7GKA0_MCL1-03      tagagaccttacgacgtgtcggggacggtgtgcagcgcaaccatcagacg
A0A8C5VB12_BCL2A1-      tggaaccgtgc---------------------ctggacaatttcaacgtc
A0A8B7FNN3_BCL2L1-      ttgaactgcggtaccggcgggcattcagtgacctga--catcccagctcc
A0A8B7FNN3_BCL2L1-      ttgaactgcggtaccggcgggcattcagtgacctga--catcccagctcc
A0A8B7FNN3_BCL2L1-      ttgaactgcggtaccggcgggcattcagtgacctga--catcccagctcc
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      acgggaacggc---------------------ctgg--agtctgag--ga
A0A8B7FJ73_BCL2L2-      acgggaacggc---------------------ctgg--agtctgag--ga
A0A8B7FJ73_BCL2L2-      tcgagacccgcttccggcgtaccttctctgatctgg--cagctcagctgc
A0A8B7FJ73_BCL2L2-      tcgagacccgcttccggcgtaccttctctgatctgg--cagctcagctgc

A0A8B7H1C6_BCL2-01      acctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccgc
A0A8C5XEX1_BCL2L10      -cct--tcgc----------------------------------------
A0A8C5VC33_MCL1-01      -tct--tcct----------------------------------------
A0A8B7GKA0_MCL1-01      gcct--tcca----------------------------------------
A0A8B7GKA0_MCL1-02      gcct--tcca----------------------------------------
A0A8B7GKA0_MCL1-03      gcct--tcca----------------------------------------
A0A8C5VB12_BCL2A1-      gcct--ccgt----------------------------------------
A0A8B7FNN3_BCL2L1-      acatcactct----------------------------------------
A0A8B7FNN3_BCL2L1-      acatcactct----------------------------------------
A0A8B7FNN3_BCL2L1-      acatcactct----------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      actggagcct----------------------------------------
A0A8B7FJ73_BCL2L2-      actggagcct----------------------------------------
A0A8B7FJ73_BCL2L2-      atgtgacccc----------------------------------------
A0A8B7FJ73_BCL2L2-      atgtgacccc----------------------------------------

A0A8B7H1C6_BCL2-01      gacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgag
A0A8C5XEX1_BCL2L10      --------ggggacgct---------------------------------
A0A8C5VC33_MCL1-01      --------atgtctggttag---------------------aaacgatgt
A0A8B7GKA0_MCL1-01      --------a-----------------------------------------
A0A8B7GKA0_MCL1-02      --------aggcatgcttcggaaactggacatcaaaaacgaagacgatgt
A0A8B7GKA0_MCL1-03      --------aggcatgcttcggaaactggacatcaaaaacgaagacgatgt
A0A8C5VB12_BCL2A1-      --------agagacggccag------------------------------
A0A8B7FNN3_BCL2L1-      --------agcgacagcata------------------------------
A0A8B7FNN3_BCL2L1-      --------agcgacagcata------------------------------
A0A8B7FNN3_BCL2L1-      --------agcgacagcata------------------------------
A0A8B7FNN3_BCL2L1-      ---------gcgacagcata------------------------------
A0A8B7FJ73_BCL2L2-      --------ggggagctgctg------------------------------
A0A8B7FJ73_BCL2L2-      --------gggga-------------------------------------
A0A8B7FJ73_BCL2L2-      --------aggctcagccca------------------------------
A0A8B7FJ73_BCL2L2-      --------aggctcagccca------------------------------

A0A8B7H1C6_BCL2-01      gggacgctttgccacggtggtggaggagctcttcagggatgg---ggtga
A0A8C5XEX1_BCL2L10      ----------tctagagagagggccgcgg------gtgaccgcctg----
A0A8C5VC33_MCL1-01      caaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaa
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      caaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaa
A0A8B7GKA0_MCL1-03      caaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaa
A0A8C5VB12_BCL2A1-      agccatcttcagtcgcgtgatggagcaggagttcggggacggcgtcgtca
A0A8B7FNN3_BCL2L1-      tcagagctttgaacaggtagtgaatgaactcttccgggatgg---ggtaa
A0A8B7FNN3_BCL2L1-      tcagagctttgaacaggtagtgaatgaactcttccgggatgg---ggtaa
A0A8B7FNN3_BCL2L1-      tcagagctttgaacaggtagtgaatgaactcttccgggatgg---ggtaa
A0A8B7FNN3_BCL2L1-      tcagagctttgaacaggtagtgaatgaactcttccgggatgg---ggtaa
A0A8B7FJ73_BCL2L2-      ctggagcccgagccggagccc------------------gag---cccga
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      gcagcgcttcacccaggtctccgatgaacttttccaaggggg---cccca
A0A8B7FJ73_BCL2L2-      gcagcgcttcacccaggtctccgatgaacttttccaaggggg---cccca

A0A8B7H1C6_BCL2-01      actgggggaggattgtggccttcttt--------------gagttcggtg
A0A8C5XEX1_BCL2L10      ---gtggaggaagtgggacctcaagc----------------c-------
A0A8C5VC33_MCL1-01      actggggcaggattgtgactctaatt----------------tcttttgg
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      actggggcaggattgtgactctaatt----------------tcttttgg
A0A8B7GKA0_MCL1-03      actggggcaggattgtgactctaatt----------------tcttttgg
A0A8C5VB12_BCL2A1-      actggggaagggtcgtgaccgtgttt--------------gcgttcggag
A0A8B7FNN3_BCL2L1-      actggggtcgcattgtggcctttttc--------------tccttcggcg
A0A8B7FNN3_BCL2L1-      actggggtcgcattgtggcctttttc--------------tccttcggcg
A0A8B7FNN3_BCL2L1-      actggggtcgcattgtggcctttttc--------------tccttcggcg
A0A8B7FNN3_BCL2L1-      actggggtcgcattgtggcctttttc--------------tccttcggcg
A0A8B7FJ73_BCL2L2-      agaggagccgccccggccccgcgcccccccgggagctccgggccctgggc
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      actggggccgccttgtggccttcttc--------------gtctttgggg
A0A8B7FJ73_BCL2L2-      actggggccgccttgtggccttcttc--------------gtctttgggg

A0A8B7H1C6_BCL2-01      gggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctgg-----
A0A8C5XEX1_BCL2L10      ---------------gcagctgaaggagggggatcccg-aagtcgcccgg
A0A8C5VC33_MCL1-01      tgcctttgtggccaaacacctgaagagcataaaccaagaaagctgcatcg
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      tgcctttgtggccaaacacttgaagagcataaatcaagaaagctgcatcg
A0A8B7GKA0_MCL1-03      tgcctttgtggccaaacacttgaagagcataaatcaagaaagctgcatcg
A0A8C5VB12_BCL2A1-      gcgtcct---caccaagagactcctgcgggagcgggcggccctggacccg
A0A8B7FNN3_BCL2L1-      gggccctgtgcgtggaaagcgtggacaaggagatgcaggtattgg--tga
A0A8B7FNN3_BCL2L1-      gggccctgtgcgtggaaagcgtggacaaggagatgcaggtattgg--tga
A0A8B7FNN3_BCL2L1-      gggccctgtgcgtggaaagcgtggacaaggagatgcaggtattgg--tga
A0A8B7FNN3_BCL2L1-      gggccctgtgcgtggaaagcgtggacaaggagatgcaggtattgg--tga
A0A8B7FJ73_BCL2L2-      ctggctcgggagccccgggcagccaggaggaggaggag------------
A0A8B7FJ73_BCL2L2-      ----------------------ccaggaggaggaggag------------
A0A8B7FJ73_BCL2L2-      ctgcactgtgtgctgagagtgtcaacaaggagatggagccactgg--tgg
A0A8B7FJ73_BCL2L2-      ctgcactgtgtgctgagagtgtcaacaaggagatggagccactgg--tgg

A0A8B7H1C6_BCL2-01      -------tggacaacatcgccctgtggatgactgagtacctgaaccggca
A0A8C5XEX1_BCL2L10      gactgccagcgcctggtggcc---ctgctgagcgcttggctcgcggggca
A0A8C5VC33_MCL1-01      aaccattagcagaaagtatca---cagacg-------ttcttgtaaggac
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      aaccattagcagaaagtatca---cagacg-------ttcttgtaaggac
A0A8B7GKA0_MCL1-03      aaccattagcagaaagtatca---cagacg-------ttcttgtaaggac
A0A8C5VB12_BCL2A1-      gacgcgtgcaagcagatttctcacctcatcgccgagttcgtagtgagcca
A0A8B7FNN3_BCL2L1-      gtcggatcgcaact----------tggatggccacttacctgaatgacca
A0A8B7FNN3_BCL2L1-      gtcggatcgcaact----------tggatggccacttacctgaatgacca
A0A8B7FNN3_BCL2L1-      gtcggatcgcaact----------tggatggccacttacctgaatgacca
A0A8B7FNN3_BCL2L1-      gtcggatcgcaact----------tggatggccacttacctgaatgacca
A0A8B7FJ73_BCL2L2-      -----gagccggga----------ctggtcgagggtgacccggggg-acg
A0A8B7FJ73_BCL2L2-      -----gagccggga----------ctggtcgagggtgacccggggg-acg
A0A8B7FJ73_BCL2L2-      gacaagtgcaggag----------tggatggtggcctacctggagacacg
A0A8B7FJ73_BCL2L2-      gacaagtgcaggag----------tggatggtggcctacctggagacacg

A0A8B7H1C6_BCL2-01      cctgcacacctggatccaggataacggaggctgggac------gccttcg
A0A8C5XEX1_BCL2L10      gcaccgcgcctggctgcaggcgcaaggtggctgggat-----ggcttttg
A0A8C5VC33_MCL1-01      aaaacgagattggctagtcaaacaaagaggctgggat-----gggtttgt
A0A8B7GKA0_MCL1-01      ---------------------------------ggat-----gggtttgt
A0A8B7GKA0_MCL1-02      aaaacgagattggctagtcaaacaaagaggctgggat-----gggtttgt
A0A8B7GKA0_MCL1-03      aaaacgagattggctagtcaaacaaagaggctgggat-----gggtttgt
A0A8C5VB12_BCL2A1-      cacgggagagtggattcggcagaacggaggctgggag-----------ca
A0A8B7FNN3_BCL2L1-      cctagagccttggatccaggagaacggcggctgggac------actttcg
A0A8B7FNN3_BCL2L1-      cctagagccttggatccaggagaacggcggctgggac------actttcg
A0A8B7FNN3_BCL2L1-      cctagagccttggatccaggagaacggcggctgggac------actttcg
A0A8B7FNN3_BCL2L1-      cctagagccttggatccaggagaacggcggctgggac------actttcg
A0A8B7FJ73_BCL2L2-      g-----------------cgccattgaggacccggagctggaagctatca
A0A8B7FJ73_BCL2L2-      g-----------------cgccattgaggacccggagctggaagctatca
A0A8B7FJ73_BCL2L2-      gctggccgactggatccacagcagtgggggctgggagctggaagctatca
A0A8B7FJ73_BCL2L2-      gctggccgactggatccacagcagtgggggctgggcg------gagttca

A0A8B7H1C6_BCL2-01      tggaattgtat-------ggccccaacatgcggcctctgt----------
A0A8C5XEX1_BCL2L10      tgacttattc-----aggaaaccct-------------------tacca-
A0A8C5VC33_MCL1-01      ggagttcttccatgtagaggacctcgaaggcggcatcagaaatgtgctg-
A0A8B7GKA0_MCL1-01      ggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctg-
A0A8B7GKA0_MCL1-02      ggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctg-
A0A8B7GKA0_MCL1-03      ggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctg-
A0A8C5VB12_BCL2A1-      cggcttc--------------------gtgaagaagtttgaaccc----a
A0A8B7FNN3_BCL2L1-      tggaactctacgggaaca---------atgcagcagctgagagccggaag
A0A8B7FNN3_BCL2L1-      tggaactctacgggaaca---------atgcagcagctgagagccggaag
A0A8B7FNN3_BCL2L1-      tggaactctacgggaaca---------atgcagcagctgagagccggaag
A0A8B7FNN3_BCL2L1-      tggaactctacgggaaca---------atgcagcagctgagagccggaag
A0A8B7FJ73_BCL2L2-      aagctc------gggtcagggagatggaggaagaagctgagaagctaaaa
A0A8B7FJ73_BCL2L2-      aagctc------gggtcagggagatggaggaagaagctgagaagctaaaa
A0A8B7FJ73_BCL2L2-      aagctc------gggtcagggagatggaggaagaagctgagaagctaaaa
A0A8B7FJ73_BCL2L2-      cagctctatacggggacggggccctggaggagg-----------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      ggcctgc-------------------------------------------
A0A8B7FNN3_BCL2L1-      ggcc----------------------------------------------
A0A8B7FNN3_BCL2L1-      ggcc----------------------------------------------
A0A8B7FNN3_BCL2L1-      ggcc----------------------------------------------
A0A8B7FNN3_BCL2L1-      ggcc----------------------------------------------
A0A8B7FJ73_BCL2L2-      gagctacagaacgaggtagagaagcagatgaatatgagtccacctccagg
A0A8B7FJ73_BCL2L2-      gagctacagaacgaggtagagaagcagatgaatatgagtccacctccagg
A0A8B7FJ73_BCL2L2-      gagctacagaacgaggtagagaagcagatgaatatgagtccacctccagg
A0A8B7FJ73_BCL2L2-      -----------cgcgg----------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------aggaa-------------
A0A8B7FNN3_BCL2L1-      --------------------------------aggaa-------------
A0A8B7FNN3_BCL2L1-      --------------------------------aggaa-------------
A0A8B7FNN3_BCL2L1-      --------------------------------aggaa-------------
A0A8B7FJ73_BCL2L2-      caatgctggcccagtgattatgtccattgaagagaaaatggaggctgatg
A0A8B7FJ73_BCL2L2-      caatgctggcccagtgattatgtccattgaagagaaaatggaggctgatg
A0A8B7FJ73_BCL2L2-      caatgctggcccagtgattatgtccattgaagagaaaatggaggctgatg
A0A8B7FJ73_BCL2L2-      --------------------cgtctgcgggaggggaactggg--------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --cgcttcaaccg-------------------------------------
A0A8B7FNN3_BCL2L1-      --cgcttcaaccg-------------------------------------
A0A8B7FNN3_BCL2L1-      --cgcttcaaccg-------------------------------------
A0A8B7FNN3_BCL2L1-      --cgcttcaaccg-------------------------------------
A0A8B7FJ73_BCL2L2-      cccgttccatctatgttggcaatgtggactatggtgcaacagcagaagag
A0A8B7FJ73_BCL2L2-      cccgttccatctatgttggcaatgtggactatggtgcaacagcagaagag
A0A8B7FJ73_BCL2L2-      cccgttccatctatgttggcaatgtggactatggtgcaacagcagaagag
A0A8B7FJ73_BCL2L2-      -------catcagtgaggacagtgctgac--gggggccgtggca------

A0A8B7H1C6_BCL2-01      ttgatttct------cctggctgtctctgaagactctgctcagcc-----
A0A8C5XEX1_BCL2L10      ctagctgtttggagg--agactgctggcccaggttct--tttgtcatgct
A0A8C5VC33_MCL1-01      ctggct-tttgcagg--tg-ttgctggagtagcagctggtttggcata--
A0A8B7GKA0_MCL1-01      ctggct-tttgcagg--tg-ttgctggagtaggagctggtttggcata--
A0A8B7GKA0_MCL1-02      ctggct-tttgcagg--tg-ttgctggagtaggagctggtttggcata--
A0A8B7GKA0_MCL1-03      ctggct-tttgcagg--tg-ttgctggagtaggagctggtttggcata--
A0A8C5VB12_BCL2A1-      ctgg---ctgacttttctggaagtctt-----------------------
A0A8B7FNN3_BCL2L1-      ctggttcctgacaggcatgactgtggc-----------------------
A0A8B7FNN3_BCL2L1-      ctggttcctgacaggcatgactgtggc-----------------------
A0A8B7FNN3_BCL2L1-      ctggttcctgacaggcatgactgtggc-----------------------
A0A8B7FNN3_BCL2L1-      ctggttcctgacaggcatgactgtggc-----------------------
A0A8B7FJ73_BCL2L2-      ctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatact
A0A8B7FJ73_BCL2L2-      ctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatact
A0A8B7FJ73_BCL2L2-      ctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatact
A0A8B7FJ73_BCL2L2-      ctgggggccc----------------------------------------

A0A8B7H1C6_BCL2-01      ---tggccctggtgggagcttgca--------------------------
A0A8C5XEX1_BCL2L10      ttttagcaacgaccgt----------------------------------
A0A8C5VC33_MCL1-01      -tctaat-a-gatagc----------------------------------
A0A8B7GKA0_MCL1-01      -tctaataa-gatagc----------------------------------
A0A8B7GKA0_MCL1-02      -tctaataa-gatag-----------------------------------
A0A8B7GKA0_MCL1-03      -tctaataa-gatag-----------------------------------
A0A8C5VB12_BCL2A1-      ---ggggaaggtctgtggc-------------------------------
A0A8B7FNN3_BCL2L1-      ---tggc-------gtgg--------------------------------
A0A8B7FNN3_BCL2L1-      ---tggc-------gtgg--------------------------------
A0A8B7FNN3_BCL2L1-      ---tggc-------gtgg--------------------------------
A0A8B7FNN3_BCL2L1-      ---tggc-------gtgg--------------------------------
A0A8B7FJ73_BCL2L2-      gtgtgacaaatttagtggccatcccaaagggtttgcatatatagagttct
A0A8B7FJ73_BCL2L2-      gtgtgacaaatttagtggccatcccaaagggtttgcatatatagagttct
A0A8B7FJ73_BCL2L2-      gtgtgacaaatttagtggccatcccaaagggtttgcatatatagagttct
A0A8B7FJ73_BCL2L2-      ---tggtaactgtaggggcctt----------------------------

A0A8B7H1C6_BCL2-01      ---------------------tcaccctgggtgcctatctgggccac---
A0A8C5XEX1_BCL2L10      --------------------------------------------catcta
A0A8C5VC33_MCL1-01      --------------------------------------------cttgta
A0A8B7GKA0_MCL1-01      --------------------------------------------cttgta
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------gtgctgtctctcctccact-----------------
A0A8B7FNN3_BCL2L1-      ---------------------ttctgctgggctca---------ctcttc
A0A8B7FNN3_BCL2L1-      ---------------------ttctgctgggctca---------ctcttc
A0A8B7FNN3_BCL2L1-      ---------------------ttctgctgggctca---------ctcttc
A0A8B7FNN3_BCL2L1-      ---------------------ttctgctgggctca---------ctcttc
A0A8B7FJ73_BCL2L2-      cagacaaagagtcagtgaggacttccctggccttagatgagtccctattt
A0A8B7FJ73_BCL2L2-      cagacaaagagtcagtgaggacttccctggccttagatgagtccctattt
A0A8B7FJ73_BCL2L2-      cagacaaagagtcagtgaggacttccctggccttagatgagtccctattt
A0A8B7FJ73_BCL2L2-      ---------------------tttcgctagc-------------------

A0A8B7H1C6_BCL2-01      ----------------aaatga----------------------------
A0A8C5XEX1_BCL2L10      tttctggacacgattattatga----------------------------
A0A8C5VC33_MCL1-01      tgtgcagtaatgggc-ttctaa----------------------------
A0A8B7GKA0_MCL1-01      a-------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      -----------------actga----------------------------
A0A8B7FNN3_BCL2L1-      agtcgg----------aaatga----------------------------
A0A8B7FNN3_BCL2L1-      agtcgg----------aaatga----------------------------
A0A8B7FNN3_BCL2L1-      agtcgg----------aaatga----------------------------
A0A8B7FNN3_BCL2L1-      agtcgg----------aaatga----------------------------
A0A8B7FJ73_BCL2L2-      agaggaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcat
A0A8B7FJ73_BCL2L2-      agaggaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcat
A0A8B7FJ73_BCL2L2-      agaggaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcat
A0A8B7FJ73_BCL2L2-      ----------------aagtga----------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      cagcacaacagaccggggtttcccacgagcccgctaccgtgcccggacta
A0A8B7FJ73_BCL2L2-      cagcacaacagaccggggtttcccacgagcccgctaccgtgcccggacta
A0A8B7FJ73_BCL2L2-      cagcacaacagaccggggtttcccacgagcccgctaccgtgcccggacta
A0A8B7FJ73_BCL2L2-      --------------------------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      ccaactacaacagttcccgctctcgattctacagtggttttaacagcagg
A0A8B7FJ73_BCL2L2-      ccaactacaacagttcccgctctcgattctacagtggttttaacagcagg
A0A8B7FJ73_BCL2L2-      ccaactacaacagttcccgctctcgattctacagtggttttaacagcagg
A0A8B7FJ73_BCL2L2-      --------------------------------------------------

A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C5XEX1_BCL2L10      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C5VB12_BCL2A1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      ccccggggtcgagtctacaggggccgggctagagcgacatcatggtattc
A0A8B7FJ73_BCL2L2-      ccccggggtcgagtctacaggggccgggctagagcgacatcatggtattc
A0A8B7FJ73_BCL2L2-      ccccggggtcgagtctacaggggccgggctagagcgacatcatggtattc
A0A8B7FJ73_BCL2L2-      --------------------------------------------------

A0A8B7H1C6_BCL2-01      ----------
A0A8C5XEX1_BCL2L10      ----------
A0A8C5VC33_MCL1-01      ----------
A0A8B7GKA0_MCL1-01      ----------
A0A8B7GKA0_MCL1-02      ----------
A0A8B7GKA0_MCL1-03      ----------
A0A8C5VB12_BCL2A1-      ----------
A0A8B7FNN3_BCL2L1-      ----------
A0A8B7FNN3_BCL2L1-      ----------
A0A8B7FNN3_BCL2L1-      ----------
A0A8B7FNN3_BCL2L1-      ----------
A0A8B7FJ73_BCL2L2-      cccttactaa
A0A8B7FJ73_BCL2L2-      cccttactaa
A0A8B7FJ73_BCL2L2-      cccttactaa
A0A8B7FJ73_BCL2L2-      ----------

© 1998-2023Legal notice