Dataset for CDS BCL-2-like of organism Microcebus murinus

[Download (right click)] [Alignment] [Repertoires]

15 sequence(s)

>gnl|bcl2dbcds|A0A8B7FJ73_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctggggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagccccgggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgggtcagggagatggaggaagaagctg
agaagctaaaagagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatt
atgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgctaccg
tgcccggactaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgagtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8B7FJ73_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaaaggtta
tgtctgtggagctggcccaggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgtaccttctctgatctggcagctcagctgcatgtgaccccaggctcagcccagcagcgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgggtcagggagatggaggaagaagct
gagaagctaaaagagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
tatgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgctacc
gtgcccggactaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgagtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8B7FJ73_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L2 (length=813 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctggggaccaggaggaggaggaggagccgggactggtcgagggtgacccgggggacggcgccattgaggac
ccggagctggaagctatcaaagctcgggtcagggagatggaggaagaagctgagaagctaaaagagctacagaacgaggt
agagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgattatgtccattgaagagaaaatggaggctg
atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaagctcactttcatggctgtggt
tcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
agagtcagtgaggacttccctggccttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaacgaacca
acagaccaggcatcagcacaacagaccggggtttcccacgagcccgctaccgtgcccggactaccaactacaacagttcc
cgctctcgattctacagtggttttaacagcaggccccggggtcgagtctacaggggccgggctagagcgacatcatggta
ttccccttactaa
>gnl|bcl2dbcds|A0A8B7FJ73_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaaaggtta
tgtctgtggagctggcccaggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgtaccttctctgatctggcagctcagctgcatgtgaccccaggctcagcccagcagcgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggcctttttcgctagcaagtga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tattgatgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcactctagcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tattgatgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcactctagcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tattgatgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcactctagcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=438 residues).
atgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggcaaccca
tcctgcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacactttcgtggaactcta
cgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggttcctgacaggcatgactgtggctg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccactgcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacccgccgcgcggtgcc
gcctgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccggcacggaagggtcacta
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccactgcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacccgccgcgcggtgcc
gcctgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccggcacggaagggtcacta
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagattggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8B7H1C6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL-2 (length=711 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagaagcgagcgctgcgcccccgggggccgtccccgcacctggcatcttctcttcccagcccg
ggggcaccccccctcccgctgcgcctcgggacccggccgccaggacctcgcccccggccgcccacgccgctgccgcgggg
cctgcgctcagcccagtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggacgccttcgtggaattgtatggccccaacatgcggcctctgtttgatttctcctggctgtctc
tgaagactctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaaatga
>gnl|bcl2dbcds|A0A8C5VB12_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2A1 (length=561 residues).
atgaagcagctccagaccctgctccccgccgggcggaagatgacgggctgcgagttcgaattcacccgagagctggccca
ggactacctgcagcatgtcctgcgggcgccgcagcccgggtccagccccagcgaggcgtcccgggtgctgcggagcgtgg
cctcctccgtccaaaacgaagtggaaaggagactggaaccgtgcctggacaatttcaacgtcgcctccgtagagacggcc
agagccatcttcagtcgcgtgatggagcaggagttcggggacggcgtcgtcaactggggaagggtcgtgaccgtgtttgc
gttcggaggcgtcctcaccaagagactcctgcgggagcgggcggccctggacccggacgcgtgcaagcagatttctcacc
tcatcgccgagttcgtagtgagccacacgggagagtggattcggcagaacggaggctgggagcacggcttcgtgaagaag
tttgaacccaggcctgcctggctgacttttctggaagtcttggggaaggtctgtggcgtgctgtctctcctccactactg
a
>gnl|bcl2dbcds|A0A8C5VC33_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=426 residues).
ctctgtgtcttatatctcagttgtgggaaaaaggatcccatgtgtttcttcctatgtctggttagaaacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactctaatttcttttggtg
cctttgtggccaaacacctgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctt
gtaaggacaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctcga
aggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtagcagctggtttggcatatctaatagatagcc
ttgtatgtgcagtaatgggcttctaa
>gnl|bcl2dbcds|A0A8C5XEX1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L10 (length=579 residues).
atgggcgacctgttcagggagcgcacggagcggctgctggccgactacctggagtactgcgccagggagccgggcacccc
ggggctgccgccgtcctcgctggaggcggccgcgctgcgcctcgcagccaccaagattcggcagaagcacgcgtctttct
tctcggcctacgtgggctacccggggaaccgcgtctccctgatggagcggatggcggaggccgtgctctccgacagcctc
agctggggccgcgtggtgatgctcctgaccttcgcggggacgcttctagagagagggccgcgggtgaccgcctggtggag
gaagtgggacctcaagccgcagctgaaggagggggatcccgaagtcgcccgggactgccagcgcctggtggccctgctga
gcgcttggctcgcggggcagcaccgcgcctggctgcaggcgcaaggtggctgggatggcttttgtgacttattcaggaaa
cccttaccactagctgtttggaggagactgctggcccaggttcttttgtcatgctttttagcaacgaccgtcatctattt
ctggacacgattattatga
© 1998-2022Legal notice