Dataset for CDS BAK1 of Organism Amazona collaria

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9FI91_BAK1-01      atggcctggccagtctgggtggtggatatagtggggcggtgggacagggt
A0A8B9FI91_BAK1-02      atg-----------------------------------------------
                        ***                                               

A0A8B9FI91_BAK1-01      tttagctgcgaagctcacgtacctgggctttgcacctcatttagtgcctg
A0A8B9FI91_BAK1-02      ---------------------------------cccttattgag------
                                                          *** *** **      

A0A8B9FI91_BAK1-01      tgaatctctgtcccgcatggtggcacagccaaaggagcagggatctgatc
A0A8B9FI91_BAK1-02      --------------------------aggtaaaagcgca-----------
                                                  **  *** * ***           

A0A8B9FI91_BAK1-01      cctccacaccatttctgtccactgcaaattttgcctcatgaaagagaccc
A0A8B9FI91_BAK1-02      --------------ctgccgagcacaaag---------------------
                                      *** * *   ****                      

A0A8B9FI91_BAK1-01      agggaagagccgtgcttccgaccaggtggccgaggagacggaggaggtgt
A0A8B9FI91_BAK1-02      -------------------gaccaggtggccgaggagacggaggaggtgt
                                           *******************************

A0A8B9FI91_BAK1-01      ttcggagctatgccttctaccgctacgagcaggagagagagga-------
A0A8B9FI91_BAK1-02      ttcggagctatgccttctaccgctacgagcaggagagagaggagcgaggg
                        *******************************************       

A0A8B9FI91_BAK1-01      --------------------------------------------------
A0A8B9FI91_BAK1-02      gaggaggtgcccgtggaccaggagatcatggacatcgaggaggagctggg
                                                                          

A0A8B9FI91_BAK1-01      ---caccgggagcctggtgggacagcgcttggccatcatcggcgacgaca
A0A8B9FI91_BAK1-02      cagcaccgggagcctggtgggacagcgcttggccatcatcggcgacgaca
                           ***********************************************

A0A8B9FI91_BAK1-01      tcaacaagcggtacgacgcggagttccgctacctgctcaagtccctgcag
A0A8B9FI91_BAK1-02      tcaacaagcggtacgacgcggagttccgctacctgctcaagtccctgcag
                        **************************************************

A0A8B9FI91_BAK1-01      cccaccaaggagaacgcctacgagtgcttcacccgagtagcctccagctt
A0A8B9FI91_BAK1-02      cccaccaaggagaacgcctacgagtgcttcacccgagtagcctccagctt
                        **************************************************

A0A8B9FI91_BAK1-01      gttcgagagcggcattaactggggccgggtgatcgcgctgctgggctttg
A0A8B9FI91_BAK1-02      gttcgagagcggcattaactggggccgggtgatcgcgctgctgggctttg
                        **************************************************

A0A8B9FI91_BAK1-01      gctaccgcatggccatccacgtgtaccagcaaggcaggaccggcttcctg
A0A8B9FI91_BAK1-02      gctaccgcatggccatccacgtgtaccagcaaggcaggaccggcttcctg
                        **************************************************

A0A8B9FI91_BAK1-01      cgctggatcgcccactgcgtcgtggagttcatgctccggaaccgcatcgc
A0A8B9FI91_BAK1-02      cgctggatcgcccactgcgtcgtggagttcatgctccggaaccgcatcgc
                        **************************************************

A0A8B9FI91_BAK1-01      ccggtggatcgcccaacagggaggatgggcggctgcactcgatctggaca
A0A8B9FI91_BAK1-02      ccggtggatcgcccaacagggaggatgggcggctgcactcgatctggaca
                        **************************************************

A0A8B9FI91_BAK1-01      atgtttccatgaagtacatgctggtgatggtggccctggtcatggtggta
A0A8B9FI91_BAK1-02      atgtttccatgaagtacatgctggtgatggtggccctggtcatggtggta
                        **************************************************

A0A8B9FI91_BAK1-01      catttagtggtacgccgcttcttcaagccctaa
A0A8B9FI91_BAK1-02      catttagtggtacgccgcttcttcaagccctaa
                        *********************************

© 1998-2023Legal notice