Dataset for CDS BAX-like of Organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H9G9C2_BAX-01           atgactggaaga--------acacagcggcacactggaggatttagagat
H9GPC1_BAX-01           atggcggcagca----------gcagcgg-atcccgggagatcgcggg--
G1K8X4_BOK-01           atg-----aagatggatgtactgcgccgctcctctgtcttcgctgcag--
A0A803TLD5_BAK1-02      atggcctcaaga--aatg----gcaacgacccaaca-------gacag--
A0A803TLD5_BAK1-01      atggcctcaaga--aatg----gcaacgacccaaca-------gacag--
                        ***     *  *           *  **                   *  

H9G9C2_BAX-01           tccaagataggacagattaaattaaatctatgtgtaatcaaatccacaga
H9GPC1_BAX-01           ---aagctggggc-----------------------------cccac---
G1K8X4_BOK-01           ---aagtgatggaagtgtttgaccggac-------------acccaccga
A0A803TLD5_BAK1-02      ---gag-gaggacagagatacgcagacc-------------atccatgga
A0A803TLD5_BAK1-01      ---gag-gaggacagagatacgcagacc-------------atccatgga
                            **    *                                ***    

H9G9C2_BAX-01           catcaaaaccagaaatgtgcagggacaaatgtcatctaacatctctgctc
H9GPC1_BAX-01           -------ctcggaaa---gcgggcac-------------cagttcagatc
G1K8X4_BOK-01           ca---------agga---gcttg----------------tgtctcagg--
A0A803TLD5_BAK1-02      aattgcattagaaga---ccagg----------------tggctcaggag
A0A803TLD5_BAK1-01      aattgcattagaaga---ccagg----------------tggctcaggag
                                      *    *  *                    ** *   

H9G9C2_BAX-01           acattcagcataaatgcttgactccatccaaatcagtctgctggaagctc
H9GPC1_BAX-01           agatccttcagacagg--------------aactgtgcttctgaagg---
G1K8X4_BOK-01           ---------------------------ccaaagtgctgtgcagaga----
A0A803TLD5_BAK1-02      a--------------------------cggaggaggtgttccagag----
A0A803TLD5_BAK1-01      a--------------------------cggaggaggtgttccagag----
                                                      *       * *         

H9G9C2_BAX-01           gacccaattctccttctccttttctcttccaggttcataagac-------
H9GPC1_BAX-01           -------------------------------gatttatttggg-------
G1K8X4_BOK-01           -----------------cttcatccactcccggctcatacgggctggcat
A0A803TLD5_BAK1-02      -----------------ctacgctttctaccggtatcaacagg-------
A0A803TLD5_BAK1-01      -----------------ctacgctttctaccggtatcaacagg-------
                                                       *                  

H9G9C2_BAX-01           -agctttggcagcaatatagagcttccaat--------------------
H9GPC1_BAX-01           -accgagtgcagagctgtggagactctgaa--------------------
G1K8X4_BOK-01           tggctggaacaagcctgaacacagcgtgcc--------------------
A0A803TLD5_BAK1-02      -agcgggagc-agactgagggggatgtgccacatgacccagaaatagctg
A0A803TLD5_BAK1-01      -agcgggagc-agactgagggggatgtgccacatgacccagaaatagctg
                           *     *     *                                  

H9G9C2_BAX-01           c---cccaggtgccccccttggagg-----aaacaaccaggg---aggac
H9GPC1_BAX-01           cgcatccagg---caacgttggcggagctcaaggaatcagagtctcggat
G1K8X4_BOK-01           tgttcccg--ggggcaagttagcag-----aggtatcca-----acatac
A0A803TLD5_BAK1-02      cgatcccgcatgagccaaatagcac-----aaattgccaggtgggcaggc
A0A803TLD5_BAK1-01      cgatcccgcatgagccaaatagcac-----aaattgccaggtgggcaggc
                             **            * *        *      **           

H9G9C2_BAX-01           ttgtcagtggaaggagcagaggcctccccagatgctgctgcagtcacgtc
H9GPC1_BAX-01           ttgtgaccctaaga-------------ccaa--------gcagttgagt-
G1K8X4_BOK-01           ttct---c-------------------------------agattaggtga
A0A803TLD5_BAK1-02      gcctggcc-------------------------------actattggtga
A0A803TLD5_BAK1-01      gcctggcc-------------------------------actattggtga
                           *                                       *      

H9G9C2_BAX-01           tctgcaagattgcat--gttccgtatatggcaggaactcagcagtaatcg
H9GPC1_BAX-01           -------gagtgcct--gcgccggattggagatgaactggacggaaatat
G1K8X4_BOK-01           tgagctggagtacattaggcccaacctttaccggaacgtagcgcgacagc
A0A803TLD5_BAK1-02      tg---------acatcaatgcccgctatgacaaggagttctcggaaatgt
A0A803TLD5_BAK1-01      tg---------acatcaatgcccgctatgacaaggagttctcggaaatgt
                                    * *     **           * *     *   *    

H9G9C2_BAX-01           tgat-------ttgaccagcatggtaga--------aagtgccactggta
H9GPC1_BAX-01           ggag-------ctgcaaagtatgatagaacaagtccaggtgtatccgcca
G1K8X4_BOK-01           tgaa--catttctttgcactctgaaacagtggtgacggatgcattcctgg
A0A803TLD5_BAK1-02      tgaagtcactccagc-caacaaaggacaacgcctatgagtactttattag
A0A803TLD5_BAK1-01      tgaagtcactccagc-caacaaaggacaacgcctatgagtactttattag
                         **              *       * *           *          

H9G9C2_BAX-01           aaaaccctctggaagtcctggctgatgtgtctgaacacctgtttgctgac
H9GPC1_BAX-01           aa--------ggaggtttttttcagagtcgctgccgagatgttctctgat
G1K8X4_BOK-01           cggtggcaacgcagatctt--------------------ttcttca----
A0A803TLD5_BAK1-02      aatagcca--gcag---tt--------------------tgtttgaaagt
A0A803TLD5_BAK1-01      aatagcca--gcag---tt--------------------tgtttgaaagt
                                  * *     *                    *  *       

H9G9C2_BAX-01           ggga---tcaactggggtcggattgttgtctttttctactttgccttccg
H9GPC1_BAX-01           gggaccttcaattggggacgagtggtagctttgttctactttgcatg-ca
G1K8X4_BOK-01           ggca---taacatggggcaagattgtgtctct-ctatgctgtggc-----
A0A803TLD5_BAK1-02      ggca---taaactggggccgtgtgatagcactgttgggcttcggcta-ca
A0A803TLD5_BAK1-01      ggca---taaactggggccgtgtgatagcactgttgggcttcggcta-ca
                        ** *   * *  *****     *  *     *  *   **  *       

H9G9C2_BAX-01           agttattgcc-----cagtatacgcca------agct----ggttccatg
H9GPC1_BAX-01           agttggtcctgaaggcaatttgcacta------aattaccagagctcata
G1K8X4_BOK-01           agctggcctt-----gc-tgtggactgtgtgcgacatgctcagccagcca
A0A803TLD5_BAK1-02      ggatggcgat-----ccatgtatacca-gcatgggatgaccggcttcctg
A0A803TLD5_BAK1-01      ggatggcgat-----ccatgtatacca-gcatgggatgaccggcttcctg
                         * *              * *   *           *             

H9G9C2_BAX-01           atg---------tggtgagttgggccatgaccttcctac---agaaccac
H9GPC1_BAX-01           aag-----accatcattagctggacaatggagtacatca---aaaatcat
G1K8X4_BOK-01           tggttcatactattgtggattgcttgggagagtttgtac-gcaagacctt
A0A803TLD5_BAK1-02      agg-----agaattgcccgctacatggctgattttgtgcttcgcaaccgc
A0A803TLD5_BAK1-01      agg-----agaattgcccgctacatggctgattttgtgcttcgcaaccgc
                          *         *       *           *   *        * *  

H9G9C2_BAX-01           ctggctaactggatccaacagcaaggaggctgggagggcctcct------
H9GPC1_BAX-01           gtcctgacctggatccaagcccagggaggatgggagggcctcct------
G1K8X4_BOK-01           ggtgacc--tggat--------gaagagaagaggaggctggagtgacata
A0A803TLD5_BAK1-02      attgcccggtggattgctcagcagggcggatgggtaggtggacctgaaag
A0A803TLD5_BAK1-01      attgcccggtggattgctcagcagggcggatgggtggcagcact------
                                 *****           * *    **  *             

H9G9C2_BAX-01           ----------------------gtcctacttcggcaccccaacttggcaa
H9GPC1_BAX-01           ----------------------gtcctacttcggcaccccgacttggcaa
G1K8X4_BOK-01           acaaaatg------tgtggtgaatactgatcc--ca-----acctccgct
A0A803TLD5_BAK1-02      ccaaattagtgttctttgtgcaggacttccac--cactgccacctcagat
A0A803TLD5_BAK1-01      ----------------------ggacttaagc--aacgtgtacttgaagt
                                                 **    *   *     ** *     

H9G9C2_BAX-01           accattgctgtatttgcggctggcgtcttgactgcttcgc----------
H9GPC1_BAX-01           actattgctgtatttgcggctggtgtcttgactgcctcgc----------
G1K8X4_BOK-01           ctcattg----gcttgtggctgcc--atttgtagctttgg----------
A0A803TLD5_BAK1-02      actcctg----atttct-tttgac--catgaggaatatgaggaaacacag
A0A803TLD5_BAK1-01      a-------------tgt-gctgat--agtggcggctgtga----------
                                      *     **      *         *           

H9G9C2_BAX-01           ----------------------------------tgaccttctggaaaat
H9GPC1_BAX-01           ----------------------------------tcaccttctggaaaat
G1K8X4_BOK-01           ----------------------------------ccacttcctgaaggcc
A0A803TLD5_BAK1-02      cctctgaacagatgtggtgggaagatgatatcattcactttgtggaattc
A0A803TLD5_BAK1-01      --tct---------tgctagg-------------ccagtttgtg------
                                                            *  *  **      

H9G9C2_BAX-01           gtct------------------------------------------taa
H9GPC1_BAX-01           gtct------------------------------------------taa
G1K8X4_BOK-01           atcttcttt----------------gtgctg---ttaccagaaagatga
A0A803TLD5_BAK1-02      ttggtatttgattatgctggacagtgttcagtgttttaccttgttttaa
A0A803TLD5_BAK1-01      -------------------------gtgcggcgtttcttcaacccatga
                                                                      * *

© 1998-2023Legal notice