Dataset for CDS BAX-like of Organism Anolis carolinensis

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A803TLD5_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anolis carolinensis GN=BAK1 (length=747 residues).
atggcctcaagaaatggcaacgacccaacagacaggaggaggacagagatacgcagaccatccatggaaattgcattaga
agaccaggtggctcaggagacggaggaggtgttccagagctacgctttctaccggtatcaacaggagcgggagcagactg
agggggatgtgccacatgacccagaaatagctgcgatcccgcatgagccaaatagcacaaattgccaggtgggcaggcgc
ctggccactattggtgatgacatcaatgcccgctatgacaaggagttctcggaaatgttgaagtcactccagccaacaaa
ggacaacgcctatgagtactttattagaatagccagcagtttgtttgaaagtggcataaactggggccgtgtgatagcac
tgttgggcttcggctacaggatggcgatccatgtataccagcatgggatgaccggcttcctgaggagaattgcccgctac
atggctgattttgtgcttcgcaaccgcattgcccggtggattgctcagcagggcggatgggtaggtggacctgaaagcca
aattagtgttctttgtgcaggacttccaccactgccacctcagatactcctgatttcttttgaccatgaggaatatgagg
aaacacagcctctgaacagatgtggtgggaagatgatatcattcactttgtggaattcttggtatttgattatgctggac
agtgttcagtgttttaccttgttttaa
>gnl|bcl2dbcds|A0A803TLD5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anolis carolinensis GN=BAK1 (length=645 residues).
atggcctcaagaaatggcaacgacccaacagacaggaggaggacagagatacgcagaccatccatggaaattgcattaga
agaccaggtggctcaggagacggaggaggtgttccagagctacgctttctaccggtatcaacaggagcgggagcagactg
agggggatgtgccacatgacccagaaatagctgcgatcccgcatgagccaaatagcacaaattgccaggtgggcaggcgc
ctggccactattggtgatgacatcaatgcccgctatgacaaggagttctcggaaatgttgaagtcactccagccaacaaa
ggacaacgcctatgagtactttattagaatagccagcagtttgtttgaaagtggcataaactggggccgtgtgatagcac
tgttgggcttcggctacaggatggcgatccatgtataccagcatgggatgaccggcttcctgaggagaattgcccgctac
atggctgattttgtgcttcgcaaccgcattgcccggtggattgctcagcagggcggatgggtggcagcactggacttaag
caacgtgtacttgaagtatgtgctgatagtggcggctgtgatcttgctaggccagtttgtggtgcggcgtttcttcaacc
catga
>gnl|bcl2dbcds|G1K8X4_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Anolis carolinensis GN=BOK (length=648 residues).
atgaagatggatgtactgcgccgctcctctgtcttcgctgcagaagtgatggaagtgtttgaccggacacccaccgacaa
ggagcttgtgtctcaggccaaagtgctgtgcagagacttcatccactcccggctcatacgggctggcattggctggaaca
agcctgaacacagcgtgcctgttcccgggggcaagttagcagaggtatccaacatacttctcagattaggtgatgagctg
gagtacattaggcccaacctttaccggaacgtagcgcgacagctgaacatttctttgcactctgaaacagtggtgacgga
tgcattcctggcggtggcaacgcagatcttttcttcaggcataacatggggcaagattgtgtctctctatgctgtggcag
ctggccttgctgtggactgtgtgcgacatgctcagccagccatggttcatactattgtggattgcttgggagagtttgta
cgcaagaccttggtgacctggatgaagagaagaggaggctggagtgacataacaaaatgtgtggtgaatactgatcccaa
cctccgctctcattggcttgtggctgccatttgtagctttggccacttcctgaaggccatcttctttgtgctgttaccag
aaagatga
>gnl|bcl2dbcds|H9G9C2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Anolis carolinensis GN=BAX (length=741 residues).
atgactggaagaacacagcggcacactggaggatttagagattccaagataggacagattaaattaaatctatgtgtaat
caaatccacagacatcaaaaccagaaatgtgcagggacaaatgtcatctaacatctctgctcacattcagcataaatgct
tgactccatccaaatcagtctgctggaagctcgacccaattctccttctccttttctcttccaggttcataagacagctt
tggcagcaatatagagcttccaatccccaggtgccccccttggaggaaacaaccagggaggacttgtcagtggaaggagc
agaggcctccccagatgctgctgcagtcacgtctctgcaagattgcatgttccgtatatggcaggaactcagcagtaatc
gtgatttgaccagcatggtagaaagtgccactggtaaaaaccctctggaagtcctggctgatgtgtctgaacacctgttt
gctgacgggatcaactggggtcggattgttgtctttttctactttgccttccgagttattgcccagtatacgccaagctg
gttccatgatgtggtgagttgggccatgaccttcctacagaaccacctggctaactggatccaacagcaaggaggctggg
agggcctcctgtcctacttcggcaccccaacttggcaaaccattgctgtatttgcggctggcgtcttgactgcttcgctg
accttctggaaaatgtcttaa
>gnl|bcl2dbcds|H9GPC1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Anolis carolinensis GN=BAX (length=624 residues).
atggcggcagcagcagcggatcccgggagatcgcgggaagctggggccccacctcggaaagcgggcaccagttcagatca
gatccttcagacaggaactgtgcttctgaagggatttatttgggaccgagtgcagagctgtggagactctgaacgcatcc
aggcaacgttggcggagctcaaggaatcagagtctcggatttgtgaccctaagaccaagcagttgagtgagtgcctgcgc
cggattggagatgaactggacggaaatatggagctgcaaagtatgatagaacaagtccaggtgtatccgccaaaggaggt
ttttttcagagtcgctgccgagatgttctctgatgggaccttcaattggggacgagtggtagctttgttctactttgcat
gcaagttggtcctgaaggcaatttgcactaaattaccagagctcataaagaccatcattagctggacaatggagtacatc
aaaaatcatgtcctgacctggatccaagcccagggaggatgggagggcctcctgtcctacttcggcaccccgacttggca
aactattgctgtatttgcggctggtgtcttgactgcctcgctcaccttctggaaaatgtcttaa
© 1998-2023Legal notice