Dataset for CDS BOK of Organism Lynx canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A667HL10_BOK-01      atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgc
A0A667HL10_BOK-02      atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgc
                       **************************************************

A0A667HL10_BOK-01      ctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggcgc
A0A667HL10_BOK-02      ctttgaccgctcgcccaccgacaaggagctggtggcccaggccaaggcgc
                       **************************************************

A0A667HL10_BOK-01      tcggccgggagttcgtgcatgcgcgactgctgcgcgccggcctcgcctgg
A0A667HL10_BOK-02      tcggccgggagttcgtgcatgcgcgactgctgcgcgccggcctcgcctgg
                       **************************************************

A0A667HL10_BOK-01      aacgcgcccgaacgcgccgctcccgcccccggaggccgcctggcggaggt
A0A667HL10_BOK-02      aacgcgcccgaacgcgccgctcccgcccccggaggccgcctggcggaggt
                       **************************************************

A0A667HL10_BOK-01      gtgcgcggtgctgctgcgcctgggagatgagctggagctgatccggccca
A0A667HL10_BOK-02      gtgcgcggtgctgctgcgcctgggagatgagctggagctgatccggccca
                       **************************************************

A0A667HL10_BOK-01      gcatctaccgcaacgtggctcgtcagctgaacatctccctgcagtctgag
A0A667HL10_BOK-02      gcatctaccgcaacgtggctcgtcagctgaacatctccctgcagtctgag
                       **************************************************

A0A667HL10_BOK-01      acagtggtgaccgacgccttcctggccgtggcagcacaaatcttctccgc
A0A667HL10_BOK-02      acagtggtgaccgacgccttcctggccgtggcagcacaaatcttctccgc
                       **************************************************

A0A667HL10_BOK-01      aggcatcacgtggggcaaggtggtgtccctgtactcagtggctgcggggc
A0A667HL10_BOK-02      a-------------------------------------------------
                       *                                                 

A0A667HL10_BOK-01      tggccgtagactgtgtgcggcaggcccagcccgccgtggtccacgctatc
A0A667HL10_BOK-02      --------------------------------------------------
                                                                         

A0A667HL10_BOK-01      gtcgactgcctcggggagtttgtgcgcaagaccctggcgccctggctgcg
A0A667HL10_BOK-02      --------------------------------------------------
                                                                         

A0A667HL10_BOK-01      gaggcgcggcggatggaccgatgtcctcaagtgtgtggtcagcaccgagc
A0A667HL10_BOK-02      ---------------gaccgatgtcctcaagtgtgtggtcagcaccgagc
                                      ***********************************

A0A667HL10_BOK-01      ccggcttccgctcacactggctggtggccgcactctgcagcttcggccgc
A0A667HL10_BOK-02      ccggcttccgctcacactggctggtggccgcactctgcagcttcggccgc
                       **************************************************

A0A667HL10_BOK-01      ttcctgaaggccgccttcttcgtgctgttgccagagagatga--------
A0A667HL10_BOK-02      ttcctgaaggccgccttcttcgtgctgttgccagagagatgagccgctgg
                       ******************************************        

A0A667HL10_BOK-01      --------------------------------------------------
A0A667HL10_BOK-02      ctcgggcagaggccgaagccaggctctccgacccaggagacccccggccc
                                                                         

A0A667HL10_BOK-01      --------------------------------------------------
A0A667HL10_BOK-02      tcgaaagcgccaacgtcctccccaaccaggctgggaacgctccgatcctc
                                                                         

A0A667HL10_BOK-01      -----------------------------------
A0A667HL10_BOK-02      agagccccgcctcggtgccggaggccctgccctga
                                                          

© 1998-2023Legal notice