Dataset for CDS BOK of Organism Lynx canadensis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A667HL10_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Lynx canadensis GN=BOK (length=642 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggccgggagttcgtgcatgcgcgactgctgcgcgccggcctcgcctggaacgcgcccg
aacgcgccgctcccgcccccggaggccgcctggcggaggtgtgcgcggtgctgctgcgcctgggagatgagctggagctg
atccggcccagcatctaccgcaacgtggctcgtcagctgaacatctccctgcagtctgagacagtggtgaccgacgcctt
cctggccgtggcagcacaaatcttctccgcaggcatcacgtggggcaaggtggtgtccctgtactcagtggctgcggggc
tggccgtagactgtgtgcggcaggcccagcccgccgtggtccacgctatcgtcgactgcctcggggagtttgtgcgcaag
accctggcgccctggctgcggaggcgcggcggatggaccgatgtcctcaagtgtgtggtcagcaccgagcccggcttccg
ctcacactggctggtggccgcactctgcagcttcggccgcttcctgaaggccgccttcttcgtgctgttgccagagagat
ga
>gnl|bcl2dbcds|A0A667HL10_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Lynx canadensis GN=BOK (length=621 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggcgctcggccgggagttcgtgcatgcgcgactgctgcgcgccggcctcgcctggaacgcgcccg
aacgcgccgctcccgcccccggaggccgcctggcggaggtgtgcgcggtgctgctgcgcctgggagatgagctggagctg
atccggcccagcatctaccgcaacgtggctcgtcagctgaacatctccctgcagtctgagacagtggtgaccgacgcctt
cctggccgtggcagcacaaatcttctccgcagaccgatgtcctcaagtgtgtggtcagcaccgagcccggcttccgctca
cactggctggtggccgcactctgcagcttcggccgcttcctgaaggccgccttcttcgtgctgttgccagagagatgagc
cgctggctcgggcagaggccgaagccaggctctccgacccaggagacccccggccctcgaaagcgccaacgtcctcccca
accaggctgggaacgctccgatcctcagagccccgcctcggtgccggaggccctgccctga
© 1998-2023Legal notice