Dataset for CDS BCL-2-like of organism Naja naja

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6VPU0_BCL2A1-      ----------------------------atggaaagct------------
A0A8C6V6T2_BCL2L1-      ----atgacaaggaggatcagccagtgcctggaacgctttgcctgcctgc
A0A8C6VLE3_MCL1-01      cgtcaccgcgcggggg--catttataac---gggcgctccgggcgcgcgc
A0A8C6VLE3_MCL1-02      cgtcaccgcgcggggg--catttataac---gggcgctccgggcgcgcgc
                                                       *   ***            

A0A8C6VPU0_BCL2A1-      -----------------------------------------------aca
A0A8C6V6T2_BCL2L1-      ctgcctcctccacattctcaacatttgctc---------cgccgcgcaca
A0A8C6VLE3_MCL1-01      cactcccctcctcagaaccaagccgtgctcgaggccggtcgccatgttca
A0A8C6VLE3_MCL1-02      cactcccctcctcagaaccaagccgtgctcgaggccggtcgccatgttca
                                                                        **

A0A8C6VPU0_BCL2A1-      at------------ttccttta-tgtgaacact---------ttggt---
A0A8C6V6T2_BCL2L1-      gc------------tccctctgctgagatctcttccccctgcttgaagcc
A0A8C6VLE3_MCL1-01      acaagaagacgatggttctgtattgcggcggct--ccccggattggcacc
A0A8C6VLE3_MCL1-02      acaagaagacgatggttctgtattgcggcggct--ccccggattggcacc
                                         ** *  ** *    **         ***     

A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      aactaactgctccttttccagggcgccattcccggggaggttggtgcctg
A0A8C6VLE3_MCL1-01      ----ggccgcccct------------cagtcccccggaggcgg-----cg
A0A8C6VLE3_MCL1-02      ----ggccgcccct------------cagtcccccggaggcgg-----cg
                                                                          

A0A8C6VPU0_BCL2A1-      ------------gcaaga-----------ttacct---------------
A0A8C6V6T2_BCL2L1-      tagccgggacgggcagggggttccatgcatcgcctgccc-----ccttct
A0A8C6VLE3_MCL1-01      gaggcggcagcggcgagggcggcctggc-tctccttcccggcggcgttcg
A0A8C6VLE3_MCL1-02      gaggcggcagcggcgagggcggcctggc-tctccttcccggcggcgttcg
                                    **  *            *  ***               

A0A8C6VPU0_BCL2A1-      --gaaatacatttgtcaagaggctc-------------------------
A0A8C6V6T2_BCL2L1-      tggaatgcgactcaccggatgactcatcgccgagtttccgcgcctggcgc
A0A8C6VLE3_MCL1-01      aggag---gcctgggcggggggctc--tgctggcctcccgccggctgcgc
A0A8C6VLE3_MCL1-02      aggag---gcctgggcggggggctc--tgctggcctcccgccggctgcgc
                          **       *   *    * ***                         

A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      tgggatggc-cgtgcccgaagcggaagggcaccgcgt------cctccta
A0A8C6VLE3_MCL1-01      tgaggggcctcgagcgctgattggcggagggccgcgcgcagggcccctct
A0A8C6VLE3_MCL1-02      tgaggggcctcgagcgctgattggcggagggccgcgcgcagggcccctct
                                                                          

A0A8C6VPU0_BCL2A1-      -------------------------------------------agctggc
A0A8C6V6T2_BCL2L1-      cggtaagcaggacggctgaggctgcagaccatggactcactgagacgggc
A0A8C6VLE3_MCL1-01      cgctgattgggaccagggacgcggccgcgcgcgcactgattg-gtcaggc
A0A8C6VLE3_MCL1-02      cgctgattgggaccagggacgcggccgcgcgcgcactgattg-gtcaggc
                                                                     * ***

A0A8C6VPU0_BCL2A1-      a------------------gcggc-------cccaaacaaagtggctgaa
A0A8C6V6T2_BCL2L1-      agaggtgtgaaaatgtcgagcggcaaccggtccctggtggtggacttcat
A0A8C6VLE3_MCL1-01      a--------------tcg-gcggcgac--gacccccgaagaggagctgga
A0A8C6VLE3_MCL1-02      a--------------tcg-gcggcgac--gacccccgaagaggagctgga
                        *                  *****       ***       *    *   

A0A8C6VPU0_BCL2A1-      gtccttcg-----------------------taaagccggatattctgct
A0A8C6V6T2_BCL2L1-      tgcctacaagctggcgcagcggggccacagctggcgcgagat--------
A0A8C6VLE3_MCL1-01      cggctgcgagcc-------cgaggcggagaccggagcggagtcttccgcc
A0A8C6VLE3_MCL1-02      cggctgcgagcc-------cgaggcggagaccggagcggagtcttccgcc
                           ** *                            **    *        

A0A8C6VPU0_BCL2A1-      ------------------------------cagaaagaagttgaaa----
A0A8C6V6T2_BCL2L1-      ---------------------ccagggcgacagcgaggagcggacggagc
A0A8C6VLE3_MCL1-01      gcctcttcctcttcttcttcccccgccccgccgggagaagccgg-ggacc
A0A8C6VLE3_MCL1-02      gcctcttcctcttcttcttcccccgccccgccgggagaagccgg-ggacc
                                                      * *  ** **  *       

A0A8C6VPU0_BCL2A1-      -------------------gcaacctgaggccttaca-------------
A0A8C6V6T2_BCL2L1-      tgtccggcgagatgg----gcagc-ggcgtcctga-----acggcgggag
A0A8C6VLE3_MCL1-01      cgctgcgccaggtgacgctgcagctggtggcctcatacctgcgggaggcg
A0A8C6VLE3_MCL1-02      cgctgcgccaggtgacgctgcagctggtggcctcatacctgcgggaggcg
                                           *** *  * * *** *               

A0A8C6VPU0_BCL2A1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      cccctcctggcaccccagccccagcccggtggtcaacggggcagccggca
A0A8C6VLE3_MCL1-01      gccgaccaggagccc---cccaagcaggacgactgcggcggcggcgggaa
A0A8C6VLE3_MCL1-02      gccgaccaggagccc---cccaagcaggacgactgcggcggcggcgggaa
                                                                          

A0A8C6VPU0_BCL2A1-      -----------------tggactcactggggattcattccgtagaag---
A0A8C6V6T2_BCL2L1-      ttcac--ccggctctcctggaagagctgggcgacggcccccaggcggcgg
A0A8C6VLE3_MCL1-01      gttcctgcagggcctgctgggccgcttcgggccctgccccgccgaggcgg
A0A8C6VLE3_MCL1-02      gttcctgcagggcctgctgggccgcttcgggccctgccccgccgaggcgg
                                         ***      * **        **   *  *   

A0A8C6VPU0_BCL2A1-      ---------------------------------aagccggcaac------
A0A8C6V6T2_BCL2L1-      tga----------ggc-----agacgctgcgggaagccggggacgagttc
A0A8C6VLE3_MCL1-01      agacggcggctcgggccctggagacgctgcggagggtctgcgacgacatc
A0A8C6VLE3_MCL1-02      agacggcggctcgggccctggagacgctgcggagggtctgcgacgacatc
                                                           * * *  **      

A0A8C6VPU0_BCL2A1-      ------------------------------------------------at
A0A8C6V6T2_BCL2L1-      gaactgcgctaccggcgggcctttagcgacctgacctcacagctccacat
A0A8C6VLE3_MCL1-01      atggagaagcaccagctggccttccaaggaatgctgaggaaagtgcagat
A0A8C6VLE3_MCL1-02      atggagaagcaccagctggccttccaaggaatgctgaggaaagtgcagat
                                                                        **

A0A8C6VPU0_BCL2A1-      ------------------------tttcaatcaagtgatggaaa------
A0A8C6V6T2_BCL2L1-      cacccccggcacggcttaccagagcttcgagcaggtggtgaacg------
A0A8C6VLE3_MCL1-01      ------cgacaaagctgatga---cttgaagcttatgtcggaagttgcaa
A0A8C6VLE3_MCL1-02      ------cgacaaagctgatga---cttgaagcttatgtcggaagttgcaa
                                                 **  * *   **  * *        

A0A8C6VPU0_BCL2A1-      -acgaatttgc--ggatgggaaaattaactggggacgcattctgacgata
A0A8C6V6T2_BCL2L1-      ---aacttttccgggacggggt---gaactgggggcggattgtggccttt
A0A8C6VLE3_MCL1-01      cacaagttttcaacgatggcataacaaactgggggcgaattgtgactctc
A0A8C6VLE3_MCL1-02      cacaagttttcaacgatggcataacaaactgggggcgaattgtgactctc
                            * *** *   ** **       ******** ** *** ** *  * 

A0A8C6VPU0_BCL2A1-      ttcctgttcggtggaatcctggctaaaaaactccaaggacctttggcaaa
A0A8C6V6T2_BCL2L1-      ttctccttcgg------aggggccctgtgcgt--ggaaagcgtcgacaag
A0A8C6VLE3_MCL1-01      atttcttttggtgcctttgttgccaaacactt--gaagagcataaatcag
A0A8C6VLE3_MCL1-02      atttcttttggtgcctttgttgccaaacactt--gaagagcataaatcag
                         *    ** **          **        *      * * *     * 

A0A8C6VPU0_BCL2A1-      agaa--------------aacttgaaacagatctcttatttcgtcacaga
A0A8C6V6T2_BCL2L1-      gaaatgcacggc---------ttggtggaga---------ggatcgccac
A0A8C6VLE3_MCL1-01      gaaa---gcggcatcagcactttggcagaga---------tcatcacgga
A0A8C6VLE3_MCL1-02      gaaa---gcggcatcagcactttggcagaga---------tcatcacgga
                          **                 ***    ***            ** *   

A0A8C6VPU0_BCL2A1-      ctacattgtga-gcaccaaaggaaa-----------gtggatcagtgaga
A0A8C6V6T2_BCL2L1-      ctggatggccacgtacctgacggaacacctggacccctggattcaagaca
A0A8C6VLE3_MCL1-01      ggtgctggtgacagagaagagagagtggctg-----ctgcatc-------
A0A8C6VLE3_MCL1-02      ggtgctggtgacagagaagagagagtggctg-----ctgcatc-------
                             * *  *   *    *   *             ** **        

A0A8C6VPU0_BCL2A1-      atggaggatgggacaatggctttataac----------------------
A0A8C6V6T2_BCL2L1-      acggaggctggg---agcgttttgtgga----------------------
A0A8C6VLE3_MCL1-01      acaatgcctgga---cgggctcgattaaattgcaaaaaagaaaaggaaca
A0A8C6VLE3_MCL1-02      acaatgcctggg---agggctttgttaaat--------------------
                        *    *  ***       * *   *                         

A0A8C6VPU0_BCL2A1-      -------------aaaatttgaggat-------aggagctcctgggtatc
A0A8C6V6T2_BCL2L1-      -tctctacgggaacgacgcggccgccaagagccggaagggccaggagcgc
A0A8C6VLE3_MCL1-01      ttttgcatgccggaaaaaaagaaaac-at--tcaaaaagaaaagaaaagc
A0A8C6VLE3_MCL1-02      tcttccatgtagaggacctggagggc-agcatcagaaacattctggtggc
                                       *    *               *            *

A0A8C6VPU0_BCL2A1-      cttatccact--ctgaagacaaagatcttggctgttttttccatcttcaa
A0A8C6V6T2_BCL2L1-      ttcaacaagtggctgtggacgggggccaccgtggccggcgtggtcct--c
A0A8C6VLE3_MCL1-01      ctctggagat--------------------g------------------a
A0A8C6VLE3_MCL1-02      ttttgcaagt--------------------gtggctggcctaggtgcgag
                         *       *                    *                   

A0A8C6VPU0_BCL2A1-      tcaatatcactcataa-----------
A0A8C6V6T2_BCL2L1-      ctgggctccctgctgagccgcaaatag
A0A8C6VLE3_MCL1-01      ttgggaccct--ccgaagagttaa---
A0A8C6VLE3_MCL1-02      cttggcttac--ttgatccggtga---
                                       *           

© 1998-2022Legal notice