Dataset for CDS BCL2L1 of organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W5JPK5_BCL2L1-      ---atgtcttacagtaacagg---gaactggtggtgttttttataagcta
A0A4W5LYF9_BCL2L1-      ---atgtcttacagtaacagg---gaactggtggtgttttttataagcta
A0A4W5NQ40_BCL2L1-      atgatgacttacaacaacaga---gaactggtggtatactatattaccta
A0A4W5R2W6_BCL2L1-      ------atgtgtattaacctacctgaactggtggtatactatattaccta
A0A4W5R2W6_BCL2L1-      attatgacttacaacaacaga---gaactggtggtatactatattaccta
                                 *  *  ***      *********** *  * *** * ***

A0A4W5JPK5_BCL2L1-      tagactgtcccagaggaattattcatgttgtcagttggggctggagggtg
A0A4W5LYF9_BCL2L1-      taaactgtcccagagaaattatccatgttgtcaattggtgctggagggtg
A0A4W5NQ40_BCL2L1-      taaactatcacagagggactaccccttcaaccacattgagctcacggaag
A0A4W5R2W6_BCL2L1-      taaactttcacagagagactaccccttcaaccacattgggctcacagaag
A0A4W5R2W6_BCL2L1-      taaactttcacagagagactaccccttcaaccacattgggctcacagaag
                        ** *** ** *****  * **  * *     **  * * ***    *  *

A0A4W5JPK5_BCL2L1-      caagtggacggactgagg-----gagatgaggccattgcaaatgggtctg
A0A4W5LYF9_BCL2L1-      caagtggacggactgagg-----gggatgaagccattgcaaatgggtctt
A0A4W5NQ40_BCL2L1-      cccagaatcggactgagg---------ggggacaggtggaagggggtgcg
A0A4W5R2W6_BCL2L1-      ctcccagtcggactgaggggggtgagaggggacaggtggaagggggggcg
A0A4W5R2W6_BCL2L1-      ctcccagtcggactgaggggggtgagaggggacaggtggaagggggggcg
                        *       **********          *   *   ** **  ***    

A0A4W5JPK5_BCL2L1-      tggggaacaacagg----aacagcagaagcaatttggcgaag--------
A0A4W5LYF9_BCL2L1-      tggggaacaacagg----aacggcagaagcaatttgggtaag--------
A0A4W5NQ40_BCL2L1-      gcagtcatgacatatgtcaacggcacagtgaacgggacgagtcccgggac
A0A4W5R2W6_BCL2L1-      gcagtcacgacacaccccaacggcacagtgaacgggacgagtcctgggac
A0A4W5R2W6_BCL2L1-      gcagtcacgacacaccccaacggcacagtgaacgggacgagtcctgggac
                           *  *  ***      *** *** *   **   *   *          

A0A4W5JPK5_BCL2L1-      ----------------------ccctcatctccacagggg------ggca
A0A4W5LYF9_BCL2L1-      ----------------------ccttcttctcctcagggg------ggca
A0A4W5NQ40_BCL2L1-      tccaccaccacagcagtcgcccccctcctcccctcggcggacagcaggcc
A0A4W5R2W6_BCL2L1-      tccaccgcga---cagtctcccccctcgtcccctcagcggacaatgggcc
A0A4W5R2W6_BCL2L1-      tccaccgcga---cagtctcccccctcgtcccctcagcggacaatgggcc
                                              ** ** ** ** * * **      *** 

A0A4W5JPK5_BCL2L1-      tggaggcagtgaaagcagcactacgggactcagtggatgagtttgagctg
A0A4W5LYF9_BCL2L1-      ttgaggcagtgaaagcagcactacgggactccgttgatgagtttgagcta
A0A4W5NQ40_BCL2L1-      tggacgcagtgaaagaggcgttgcgggactctgccaatgagtttgagctg
A0A4W5R2W6_BCL2L1-      tggacgcagtgaaagaggcattgcgggactctgccaatgagtttgagctg
A0A4W5R2W6_BCL2L1-      tggacgcagtgaaagaggcattgcgggactctgccaatgagtttgagctg
                        * ** **********  **  * ******** *   ************* 

A0A4W5JPK5_BCL2L1-      cgctacacccgtgccttcagtgacctctcctcccagctccacatcacccc
A0A4W5LYF9_BCL2L1-      cgctacacccgcgccttcagtgatctctgctcccagctccacatcacccc
A0A4W5NQ40_BCL2L1-      cgttatgccagagcgttcagtgacctgtcctcccagctacacatcacgcc
A0A4W5R2W6_BCL2L1-      cgttatgccagagcgtttagtgacctgtcctcccagctgcacatcacgcc
A0A4W5R2W6_BCL2L1-      cgttatgccagagcgtttagtgacctgtcctcccagctgcacatcacgcc
                        ** **  ** * ** ** ***** ** * ********* ******** **

A0A4W5JPK5_BCL2L1-      tgccacagcctaccacagctttgagagtgtgatggacgaagtgttcaggg
A0A4W5LYF9_BCL2L1-      tgccacagcctaccacagctttgagagcgtgatggacgaagtgttcaggg
A0A4W5NQ40_BCL2L1-      gtccacagcctaccagagctttgagaacgtgatggacgaggtgttccggg
A0A4W5R2W6_BCL2L1-      ggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtg
A0A4W5R2W6_BCL2L1-      ggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtg
                          ************* ***** ****  ******** ** ** *** * *

A0A4W5JPK5_BCL2L1-      acggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcc
A0A4W5LYF9_BCL2L1-      acggggtaaactggggtcgtgtggtgggcctgtttgctttcggcggggcc
A0A4W5NQ40_BCL2L1-      acggtgtgaactggggacgggtggtgggcctgtttgctttcggaggggcc
A0A4W5R2W6_BCL2L1-      atggtgtgaactggggacgggtggtgggcctgtttgcctttggaggggcc
A0A4W5R2W6_BCL2L1-      atggtgtgaactggggacgggtggtgggcctgtttgcctttggaggggcc
                        * ** ** ******** ** ******** ******** ** ** ******

A0A4W5JPK5_BCL2L1-      ttgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcat
A0A4W5LYF9_BCL2L1-      ctgtgcgttgagtgtgttgagaaggatatgagccccctggtgatgcgcat
A0A4W5NQ40_BCL2L1-      ctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggat
A0A4W5R2W6_BCL2L1-      ctctgtgtagagtgtgtggagaaggagatgagcccactagtgggacggat
A0A4W5R2W6_BCL2L1-      ctctgtgtagagtgtgtggagaaggagatgagcccactagtgggacggat
                         * ** ** ** ***** ** ***** **** ***  * ***    * **

A0A4W5JPK5_BCL2L1-      cgcagactggatgaccacctacctggacaaccatatccagccctggatcc
A0A4W5LYF9_BCL2L1-      cgcagactggatggccacctacctggacaaccatatccagccctggatcc
A0A4W5NQ40_BCL2L1-      cacagactggatgactgtctacctggacaaccacatccagccctggatcc
A0A4W5R2W6_BCL2L1-      tgcagactggatgacagtctacctggacaaccacatccagccctggatcc
A0A4W5R2W6_BCL2L1-      tgcagactggatgacagtctacctggacaaccacatccagccctggatcc
                          *********** *   *************** ****************

A0A4W5JPK5_BCL2L1-      agagccaaggaggatgggaccgttttgcaaagatctttggcagagatgct
A0A4W5LYF9_BCL2L1-      agagtcaaggaggatgggaccgttttgcattgatcttcggcagagatgca
A0A4W5NQ40_BCL2L1-      agagccaaggaggatgggaccggtttgcagagatctttgggatggacgct
A0A4W5R2W6_BCL2L1-      agagccaaggaggatgggaccggtttgcagagatctttgggaaggacgct
A0A4W5R2W6_BCL2L1-      agagccaaggaggatgggaccggtttgcagagatctttgggaaggacgct
                        **** ***************** ******  ****** ** *  ** ** 

A0A4W5JPK5_BCL2L1-      gctgcagacgttcgacggtcccaggagagcataattaaatggctgctagt
A0A4W5LYF9_BCL2L1-      gctgcagacgtccgacggtcccaggagagcttaagaaaatggctgctagt
A0A4W5NQ40_BCL2L1-      gcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggc
A0A4W5R2W6_BCL2L1-      gcagccgagaacaggaagtctcaggagagctttaagaagtggttgctggc
A0A4W5R2W6_BCL2L1-      gcagccgagaacaggaagtctcaggagagctttaagaagtggttgctggc
                        ** ** **     *   *** ********* * *  ** *** * ** * 

A0A4W5JPK5_BCL2L1-      tggggtgattctgctttcaggagtgctggttggcactctcatcatgaaga
A0A4W5LYF9_BCL2L1-      tggggtcatgctgctttcaggagtactggtcggcactctcatcatgaaga
A0A4W5NQ40_BCL2L1-      ggggatgacgctggttacaggagtcgtcgtagggtcactctttgctcaga
A0A4W5R2W6_BCL2L1-      ggggatgacgctggtcacaggagtcatcttagggtcactcattgctcaga
A0A4W5R2W6_BCL2L1-      ggggatgacgctggtcacaggagtcatcttagggtcactcattgctcaga
                         *** * *  *** *  *******  *  * **  * *** *     ***

A0A4W5JPK5_BCL2L1-      aacgccagtga
A0A4W5LYF9_BCL2L1-      aatgccagtga
A0A4W5NQ40_BCL2L1-      aacgcctgtga
A0A4W5R2W6_BCL2L1-      aacgcctgtga
A0A4W5R2W6_BCL2L1-      aacgcctgtga
                        ** *** ****

© 1998-2020Legal notice