Dataset for CDS BAK1 of Organism Apteryx owenii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9NSG1_BAK1-01      atggcctcagggaacgacggtgacccaccaggcgcccgtgtacgctggga
A0A8B9NSG1_BAK1-02      atggcctcagggaacgacggtgacccaccaggcgcccgtgtacgctggga
                        **************************************************

A0A8B9NSG1_BAK1-01      tggtgatgggcgcaggctatcacaagaggtcaattcagaagaccaggtgg
A0A8B9NSG1_BAK1-02      tggtgatgggcgcaggctatcacaagaggtcaattcagaagaccaggtgg
                        **************************************************

A0A8B9NSG1_BAK1-01      ctgagcagaccgaggaggtgtttcggagctatgccttccaccgctaccaa
A0A8B9NSG1_BAK1-02      ctgagcagaccgaggaggtgtttcggagctatgccttccaccgctaccaa
                        **************************************************

A0A8B9NSG1_BAK1-01      caggagagagaagagagaggggaggaagtgcccatggacccagagattgc
A0A8B9NSG1_BAK1-02      caggagagagaagagagaggggaggaagtgcccatggacccagagattgc
                        **************************************************

A0A8B9NSG1_BAK1-01      ggagattcagcaggagccaagcagcacggggagcctggtgggaagacgcc
A0A8B9NSG1_BAK1-02      ggagattcagcaggagccaagcagcacggggagcctggtgggaagacgcc
                        **************************************************

A0A8B9NSG1_BAK1-01      tggccatcatcggcgacgacattaatgagcggtacgacgcggagtttcgc
A0A8B9NSG1_BAK1-02      tggccatcatcggcgacgacattaatgagcggtacgacgcggagtttcgc
                        **************************************************

A0A8B9NSG1_BAK1-01      tgcatgctgaaatccttgcagcccaccaaggaaaacgcctacgagtactt
A0A8B9NSG1_BAK1-02      tgcatgctgaaatccttgcagcccaccaaggaaaacgcctacgagtactt
                        **************************************************

A0A8B9NSG1_BAK1-01      caccaggatagcctccagcttgttcgagagtggcattaactggggccggg
A0A8B9NSG1_BAK1-02      caccaggatagcctccagcttgttcgagagtggcattaactggggccggg
                        **************************************************

A0A8B9NSG1_BAK1-01      tgattgcactgctgggctttggctaccgcatggccatccacgtctatcag
A0A8B9NSG1_BAK1-02      tgattgcactgctgggctttggctaccgcatggccatccacgtctatcag
                        **************************************************

A0A8B9NSG1_BAK1-01      catggcataacaggtttcctccgccggatcgcccgctacgttgcggagtt
A0A8B9NSG1_BAK1-02      catggcataacaggtttcctccgccggatcgcccgctacgttgcggagtt
                        **************************************************

A0A8B9NSG1_BAK1-01      catgctccggaaccgcattgcccagtggatcgcccagcagggaggatggg
A0A8B9NSG1_BAK1-02      catgctccggaaccgcattgcccagtggatcgcccagcagggaggatggg
                        **************************************************

A0A8B9NSG1_BAK1-01      tggctgcactcgatctggacaatgtttacatgaagtatatgctggcggtg
A0A8B9NSG1_BAK1-02      tggctgcactcgatctggacaatgtttacatgaagtatatgctggcggtg
                        **************************************************

A0A8B9NSG1_BAK1-01      gtggccctggtcatggtggggcatttagtggtacgacgcttcttcaggcc
A0A8B9NSG1_BAK1-02      gtggccctggtcatggtggggcatttagtggtacgacgcttcttcaggcc
                        **************************************************

A0A8B9NSG1_BAK1-01      ctga
A0A8B9NSG1_BAK1-02      ctga
                        ****

© 1998-2023Legal notice