Dataset for CDS MCL-1 of organism Denticeps clupeoides

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C4BCS5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Denticeps clupeoides GN=MCL-1 (length=774 residues).
atgagcctgagcgccatgaagcgtccggcgggcagcgtgatcggcctgctctgctcgcacttcgcggttccatgcgcggt
cgcggacaacaaaggggaccccggggacgagctggacgaggcggactctttcgcgctgaagcccgagcgccgggacatgg
gcctggacagcggcttccagagctccgacgacgacgcgtccctgcccgcgtcccccgacgggccgccgcgcacgatcctg
gaccgcgaccgcgacgccctggagctcgagaccaggcagctcgtcggcgacttctaccggatctacgtcggagggaagcc
cgccgacacgcgtccgcacaacgcgctgccgaccatgaggaaagtcgtggacgaggtgctgcggaagcaccagatatctt
tcaaaagtatggtccagaaattggtgctgcagtctcagaacgagaagatggcctttgttacggcagtcgccaagaacata
tttaaagatggaaccaccaactggggccgcatcgccagcctggtggcatttggggccgtggtctgccgagaactgaaggc
gattgacagggaggactgtgtggagaccgtgactacgcagatctgcacgtacctcgccaccgaacaaagggagtggttcg
tcaataacagcggctgggttggctttgtggacttctttcacgtggaggatccagagactgtagtctggaacaccttgatt
gcagtagcaggcttcgcggggctgggagctggcctggcgctcatgatcagatga
© 1998-2022Legal notice