Dataset for CDS BOK of Organism Cyprinus carpio

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C1J6C3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cyprinus carpio GN=BOK (length=672 residues).
atggagatgttgcgccgctcctcagtgttcgcggctgaagtcatggaggtgtttgatcgctctcccacggataaggagct
cgtgtctcagtctaaagtcttgtgcagggattacattcactccagactccatcgggctggaatcggatggtctaaaccag
agcatggatccggaggaacactggctgaggtgtcttcagttcttctgtggttgggtgatgagctggagtacctgcgaccc
aatgtgtaccgcaacgtagcaagacagctcaacatcactattgcatctgagagtatagtctctgatgcctttttggccgt
tgctgccgaaatcttctctacaggcaattatttcagaaagtacaccttggaaaaatacccaggtgtaacatgggggaaga
ttgtatctctgtatgctgtggccggagctctagccgtggactgtgttcggcatgggcatccagcgatggtgcacaccatt
gtcgactgcatgggcgagtttgttcgcaaaagccttgtgtcatggttaaagaggagaggaggctgggcggacatcacaaa
gtgtgtagtcaatacagatcccagttttcgttctcattggctggtggcagctgcctgtgcctgcggtcactatctcaagg
ctgtggtcttctacctgctgagagaaaaataa
>gnl|bcl2dbcds|A0A8C1J6C3_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Cyprinus carpio GN=BOK (length=642 residues).
atgaagggcatggagatgttgcgccgctcctcagtgttcgcggctgaagtcatggaggtgtttgatcgctctcccacgga
taaggagctcgtgtctcagtctaaagtcttgtgcagggattacattcactccagactccatcgggctggaatcggatggt
ctaaaccagagcatggatccggaggaacactggctgaggtgtcttcagttcttctgtggttgggtgatgagctggagtac
ctgcgacccaatgtgtaccgcaacgtagcaagacagctcaacatcactattgcatctgagagtatagtctctgatgcctt
tttggccgttgctgccgaaatcttctctacaggtgtaacatgggggaagattgtatctctgtatgctgtggccggagctc
tagccgtggactgtgttcggcatgggcatccagcgatggtgcacaccattgtcgactgcatgggcgagtttgttcgcaaa
agccttgtgtcatggttaaagaggagaggaggctgggcggacatcacaaagtgtgtagtcaatacagatcccagttttcg
ttctcattggctggtggcagctgcctgtgcctgcggtcactatctcaaggctgtggtcttctacctgctgagagaaaaat
aa
>gnl|bcl2dbcds|A0A8C1J6C3_BOK-03 BCL2-related ovarian killer gene OS=[Eukaryota] Cyprinus carpio GN=BOK (length=582 residues).
atgttgcgccgctcctcagtgttcgcggctgaagtcatggaggtgtttgatcgctctcccacggataaggagctcgtgtc
tcagtctaaagtcttgtgcagggattacattcactccagactccatcgggaacactggctgaggtgtcttcagttcttct
gtggtgatgagctggagtacctgcgacccaatgtgtaccgcaacgtagcaagacagctcaacatcactattgcatctgag
agtatagtctctgatgcctttttggccgttgctgccgaaatcttctctacaggtgtaacatgggggaagattgtatctct
gtatgctgtggccggagctctagccgtggactgtgttcggcatgggcatccagcgatggtgcacaccattgtcgactgca
tgggcgagtttgttcgcaaaagccttgtgtcatggttaaagaggagaggaggctgggcggacatcacaaagtgtgtagtc
aatacagatcccagttttcgttctcattggctggtggcagctgcctgtgcctgcggtcactatctcaaggctgtggtctt
ctacctgctgagagaaaaataa
© 1998-2023Legal notice