Dataset for CDS BOK of Organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1J6C3_BOK-01      ---------atggagatgttgcgccgctcctcagtgttcgcggctgaagt
A0A8C1J6C3_BOK-02      atgaagggcatggagatgttgcgccgctcctcagtgttcgcggctgaagt
A0A8C1J6C3_BOK-03      ---------------atgttgcgccgctcctcagtgttcgcggctgaagt
                                      ***********************************

A0A8C1J6C3_BOK-01      catggaggtgtttgatcgctctcccacggataaggagctcgtgtctcagt
A0A8C1J6C3_BOK-02      catggaggtgtttgatcgctctcccacggataaggagctcgtgtctcagt
A0A8C1J6C3_BOK-03      catggaggtgtttgatcgctctcccacggataaggagctcgtgtctcagt
                       **************************************************

A0A8C1J6C3_BOK-01      ctaaagtcttgtgcagggattacattcactccagactccatcgggctgga
A0A8C1J6C3_BOK-02      ctaaagtcttgtgcagggattacattcactccagactccatcgggctgga
A0A8C1J6C3_BOK-03      ctaaagtcttgtgcagggattacattcactccagactccatcg-------
                       *******************************************       

A0A8C1J6C3_BOK-01      atcggatggtctaaaccagagcatggatccggaggaacactggctgaggt
A0A8C1J6C3_BOK-02      atcggatggtctaaaccagagcatggatccggaggaacactggctgaggt
A0A8C1J6C3_BOK-03      ---------------------------------ggaacactggctgaggt
                                                        *****************

A0A8C1J6C3_BOK-01      gtcttcagttcttctgtggttgggtgatgagctggagtacctgcgaccca
A0A8C1J6C3_BOK-02      gtcttcagttcttctgtggttgggtgatgagctggagtacctgcgaccca
A0A8C1J6C3_BOK-03      gtcttcagttcttctgt-----ggtgatgagctggagtacctgcgaccca
                       *****************     ****************************

A0A8C1J6C3_BOK-01      atgtgtaccgcaacgtagcaagacagctcaacatcactattgcatctgag
A0A8C1J6C3_BOK-02      atgtgtaccgcaacgtagcaagacagctcaacatcactattgcatctgag
A0A8C1J6C3_BOK-03      atgtgtaccgcaacgtagcaagacagctcaacatcactattgcatctgag
                       **************************************************

A0A8C1J6C3_BOK-01      agtatagtctctgatgcctttttggccgttgctgccgaaatcttctctac
A0A8C1J6C3_BOK-02      agtatagtctctgatgcctttttggccgttgctgccgaaatcttctcta-
A0A8C1J6C3_BOK-03      agtatagtctctgatgcctttttggccgttgctgccgaaatcttctcta-
                       ************************************************* 

A0A8C1J6C3_BOK-01      aggcaattatttcagaaagtacaccttggaaaaatacccaggtgtaacat
A0A8C1J6C3_BOK-02      --------------------------------------caggtgtaacat
A0A8C1J6C3_BOK-03      --------------------------------------caggtgtaacat
                                                             ************

A0A8C1J6C3_BOK-01      gggggaagattgtatctctgtatgctgtggccggagctctagccgtggac
A0A8C1J6C3_BOK-02      gggggaagattgtatctctgtatgctgtggccggagctctagccgtggac
A0A8C1J6C3_BOK-03      gggggaagattgtatctctgtatgctgtggccggagctctagccgtggac
                       **************************************************

A0A8C1J6C3_BOK-01      tgtgttcggcatgggcatccagcgatggtgcacaccattgtcgactgcat
A0A8C1J6C3_BOK-02      tgtgttcggcatgggcatccagcgatggtgcacaccattgtcgactgcat
A0A8C1J6C3_BOK-03      tgtgttcggcatgggcatccagcgatggtgcacaccattgtcgactgcat
                       **************************************************

A0A8C1J6C3_BOK-01      gggcgagtttgttcgcaaaagccttgtgtcatggttaaagaggagaggag
A0A8C1J6C3_BOK-02      gggcgagtttgttcgcaaaagccttgtgtcatggttaaagaggagaggag
A0A8C1J6C3_BOK-03      gggcgagtttgttcgcaaaagccttgtgtcatggttaaagaggagaggag
                       **************************************************

A0A8C1J6C3_BOK-01      gctgggcggacatcacaaagtgtgtagtcaatacagatcccagttttcgt
A0A8C1J6C3_BOK-02      gctgggcggacatcacaaagtgtgtagtcaatacagatcccagttttcgt
A0A8C1J6C3_BOK-03      gctgggcggacatcacaaagtgtgtagtcaatacagatcccagttttcgt
                       **************************************************

A0A8C1J6C3_BOK-01      tctcattggctggtggcagctgcctgtgcctgcggtcactatctcaaggc
A0A8C1J6C3_BOK-02      tctcattggctggtggcagctgcctgtgcctgcggtcactatctcaaggc
A0A8C1J6C3_BOK-03      tctcattggctggtggcagctgcctgtgcctgcggtcactatctcaaggc
                       **************************************************

A0A8C1J6C3_BOK-01      tgtggtcttctacctgctgagagaaaaataa
A0A8C1J6C3_BOK-02      tgtggtcttctacctgctgagagaaaaataa
A0A8C1J6C3_BOK-03      tgtggtcttctacctgctgagagaaaaataa
                       *******************************

© 1998-2023Legal notice