Dataset for CDS BCL2L2 of organism Bos mutus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

L8HP19_BCL2L2-01      atggcgaccccagcctcggccccagacacacgggctctagtggcagactt
L8HP19_BCL2L2-02      atggcgaccccagcctcggccccagacacacgggctctagtggcagactt

L8HP19_BCL2L2-01      tgtgggctataagctgaggcagaaggggtatgtttgtggagctggccccg
L8HP19_BCL2L2-02      tgtgggctataagctgaggcagaaggggtatgtttgtggagctggccccg

L8HP19_BCL2L2-01      gggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
L8HP19_BCL2L2-02      gggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga

L8HP19_BCL2L2-01      gatgagttcgagacccgcttccggcgcaccttctccgatctggcagctca
L8HP19_BCL2L2-02      gatgagttcgagacccgcttccggcgcaccttctccgatctggcagctca

L8HP19_BCL2L2-01      gctgcatgtgaccccgggctcggcccagcaacgcttcacccaggtctctg
L8HP19_BCL2L2-02      gctgcatgtgaccccgggctcggcccagcaacgcttcacccaggtctctg

L8HP19_BCL2L2-01      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
L8HP19_BCL2L2-02      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt

L8HP19_BCL2L2-01      gtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatggagcc
L8HP19_BCL2L2-02      gtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatggagcc

L8HP19_BCL2L2-01      acttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
L8HP19_BCL2L2-02      acttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc

L8HP19_BCL2L2-01      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
L8HP19_BCL2L2-02      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta

L8HP19_BCL2L2-01      tacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactg
L8HP19_BCL2L2-02      tacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactg

L8HP19_BCL2L2-01      ggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctgg
L8HP19_BCL2L2-02      ggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctgg

L8HP19_BCL2L2-01      taactgtaggggccttttttgctagcaagtga
L8HP19_BCL2L2-02      taactgtaggggccttttttgctagcaagtga

© 1998-2022Legal notice