Dataset for CDS BAX-like of Organism Bos mutus grunniens

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A8B9W5U0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Bos mutus grunniens GN=BOK (length=579 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggctctcggccgcgagttcgtgcacgcgcgactgctgcgcgctggcctctcctggagcgcgcccg
agcgcgccgcgccggtccccggcggccgcctggcggaggtgtgcgccgtgctgctgcgcctggcggacgagctggagctg
atccggcccagtgtctaccgcaacgtggcccgccagctgaacctctccctgcagtcggagaccgtggtgaccgacgcctt
cctggctgtggcgacccagatcttttctgcaggtatcacgtggggcaaagttgtgtccctgtactccgtggccgcgggct
ggccgtggactgtagccttccaggctcctcaatccatgggattttccaggcaagagtactggagtggggtgccattgtct
tctccgtctgctttattgagtacgcctattgtattattagtatttttactttgtgaatccactattcatttgtgttccca
tttcttcagaaactgttga
>gnl|bcl2dbcds|A0A8B9W5U0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Bos mutus grunniens GN=BOK (length=642 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggctctcggccgcgagttcgtgcacgcgcgactgctgcgcgctggcctctcctggagcgcgcccg
agcgcgccgcgccggtccccggcggccgcctggcggaggtgtgcgccgtgctgctgcgcctggcggacgagctggagctg
atccggcccagtgtctaccgcaacgtggcccgccagctgaacctctccctgcagtcggagaccgtggtgaccgacgcctt
cctggctgtggcgacccagatcttttctgcaggtatcacgtggggcaaagttgtgtccctgtactccgtggccgcggggc
tggccgtggactgtgtgcggcaggcccagcccgccctggtgcacgccctcgtcgactgtctcggggagtttgtgcggaag
acgctggcaacctggctgcggaggcgtggtggatggacggacgtgctcaagtgcgtggtcagcaccgacccgggcctgcg
ctcgcactggctggtggccgcgctctgcagctttggccgcttcctgaaggcagccttcttcatgctgttgccggagagat
ga
>gnl|bcl2dbcds|A0A8B9Y453_BAX-01 BCL2-associated X gene OS=[Eukaryota] Bos mutus grunniens GN=BAX (length=528 residues).
atgagctcccagattcgtcagaattattctaccgaggtggaggccgccgtcaaccgcctggttaacatgcaactgcgggc
ctcctacacctacctctctctgggcttctatttcgaccgcgacgatgtggccctggagggtgtgggtcacttttttcgcg
aattggccaaggagaagcgcgagggcgcggagcgtctcttgaaactgcaaaaccagcgtggcggccgcgccctcttcctg
gacgtgcagaagccatctcaagatgagtggggtaaaacccaggacgctatggaggccgcccttctcgtagagaagaacct
gaatcaagccctgttggatctgcatggcctggcttctgcccgcggagacccccacatctgtgacttcctggagaaccact
tcctagatgaggaagtgaaactcatcaagaagatgggtgaccacctgaccaacctccgcaggctggctggtccccaggct
gggttgggcgagtatctcttcgaaaggctcaccctcaagcacgactag
>gnl|bcl2dbcds|A0A8B9Y453_BAX-02 BCL2-associated X gene OS=[Eukaryota] Bos mutus grunniens GN=BAX (length=585 residues).
ggttccccaagacgcccccagcccaagtttccctcagctgcgcacctcaggccctctgcgcacgcgctggccttctttgt
ccccttcgatagtcagaaggcagagtccggttgcctggcctcgcctcctgcttaccattgttcccgccatctcttcctgc
agggcttctatttcgaccgcgacgatgtggccctggagggtgtgggtcacttttttcgcgaattggccaaggagaagcgc
gagggcgcggagcgtctcttgaaactgcaaaaccagcgtggcggccgcgccctcttcctggacgtgcagccatctcaaga
tgagtggggtaaaacccaggacgctatggaggccgcccttctcgtagagaagaacctgaatcaagccctgttggatctgc
atggcctggcttctgcccgcggagacccccacatctgtgacttcctggagaaccacttcctagatgaggaagtgaaactc
atcaagaagatgggtgaccacctgaccaacctccgcaggctggctggtccccaggctgggttgggcgagtatctcttcga
aaggctcaccctcaagcacgactag
>gnl|bcl2dbcds|A0A8B9Y453_BAX-03 BCL2-associated X gene OS=[Eukaryota] Bos mutus grunniens GN=BAX (length=759 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttccgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttggtcgcaa
ccttcggagtcagccactcagctgtccgcgatcaccgggaccagccaccattttttaactccttattattaccgaccaat
catgagctcccagattcgtcagaattattctaccgaggtggaggccgccgtcaaccgcctggttaacatgcaactgcggg
cctcctacacctacctctctctggtgaggttccccaagacgcccccagcccaagtttccctcagctgcgcacctcaggcc
ctctgcgcacgcgctggccttctttgtccccttcgatag
>gnl|bcl2dbcds|A0A8B9Y453_BAX-04 BCL2-associated X gene OS=[Eukaryota] Bos mutus grunniens GN=BAX (length=759 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttccgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttggtcgcaa
ccttcggagtcagccactcagctgtccgcgatcaccgggaccagccaccattttttaactccttattattaccgaccaat
catgagctcccagattcgtcagaattattctaccgaggtggaggccgccgtcaaccgcctggttaacatgcaactgcggg
cctcctacacctacctctctctggtgaggttccccaagacgcccccagcccaagtttccctcagctgcgcacctcaggcc
ctctgcgcacgcgctggccttctttgtccccttcgatag
>gnl|bcl2dbcds|A0A8B9Y453_BAX-05 BCL2-associated X gene OS=[Eukaryota] Bos mutus grunniens GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttccgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A8B9Y453_BAX-06 BCL2-associated X gene OS=[Eukaryota] Bos mutus grunniens GN=BAX (length=432 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgatcgcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttccgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtg
cccgagttgatcaggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccaggg
tggttgggacggcctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccg
cctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A8B9Y453_BAX-07 BCL2-associated X gene OS=[Eukaryota] Bos mutus grunniens GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttccgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A8B9YH53_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BAK1 (length=462 residues).
atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcctgacccctcctccacctcagaggagcaggt
agcccgggacaccgaggaggtcttccgcagctacgtcttttaccgccatcagcaggaacaggaggccgagggggcggctg
cgcctactgacccagagatggtcaccttgcacccagaacctagcagcaccatggggcaggtgggccgccagctcgccgtc
atcggggacgacatcaaccggcgctatgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgc
ctatgagtacttcaccaagatcgcgtccaggccagcagcagcacccacagcctgtttgagagcggtatcaactggggccg
cgtggtggctctgctgggctttggctaccgcctggccctccacgtctaccagcgtggcctga
>gnl|bcl2dbcds|A0A8B9YH53_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BAK1 (length=636 residues).
atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcctgacccctcctccacctcagaggagcaggt
agcccgggacaccgaggaggtcttccgcagctacgtcttttaccgccatcagcaggaacaggaggccgagggggcggctg
cgcctactgacccagagatggtcaccttgcacccagaacctagcagcaccatggggcaggtgggccgccagctcgccgtc
atcggggacgacatcaaccggcgctatgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgc
ctatgagtacttcaccaagatcgcgtccagcctgtttgagagcggtatcaactggggccgcgtggtggctctgctgggct
ttggctaccgcctggccctccacgtctaccagcgtggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgctgcgtcgctccatcgcccggtggatcgcgcagaggggtggctgggtggcagccctggacttggggaacggccc
catcaagagcgtagccatcgttctggctgtggttttgttgggccagtttgtggtacgaagattcttcaagtcatga
© 1998-2023Legal notice