Dataset for CDS BAX-like of Organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9Y453_BAX-03       atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-04       atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-05       atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-07       atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-06       atggacgggtccggggagcaacccagaggcggggggcccaccag------
A0A8B9Y453_BAX-01       ----------------atgagctcccaga-------ttcgtcag------
A0A8B9Y453_BAX-02       -------ggttccccaagacgcccccagcccaagtttccctcagctgcgc
A0A8B9YH53_BAK1-01      atg-----gcttccggacaaggcccaggtc--------------------
A0A8B9YH53_BAK1-02      atg-----gcttccggacaaggcccaggtc--------------------
A0A8B9W5U0_BOK-01       atggaggtgctgcggcgc---tcctcggtc--------------------
A0A8B9W5U0_BOK-02       atggaggtgctgcggcgc---tcctcggtc--------------------
                                               *   *                      

A0A8B9Y453_BAX-03       ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-04       ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-05       ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-07       ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-06       ----------ctctgagcagat----------------------------
A0A8B9Y453_BAX-01       -----aattattctaccgaggtggaggccgccgtcaaccgcc----tggt
A0A8B9Y453_BAX-02       acctcaggccctctgcgcacgcgctggccttctttgtccccttcgatagt
A0A8B9YH53_BAK1-01      --------cccccgggcaggactgc-gacgagcctgacccctcctccacc
A0A8B9YH53_BAK1-02      --------cccccgggcaggactgc-gacgagcctgacccctcctccacc
A0A8B9W5U0_BOK-01       --------ttcgccgccgagatcatggacgcctttgaccgctcgcccacc
A0A8B9W5U0_BOK-02       --------ttcgccgccgagatcatggacgcctttgaccgctcgcccacc
                                    *                                     

A0A8B9Y453_BAX-03       ---catg-----------aagacag------ggg----------------
A0A8B9Y453_BAX-04       ---catg-----------aagacag------ggg----------------
A0A8B9Y453_BAX-05       ---catg-----------aagacag------ggg----------------
A0A8B9Y453_BAX-07       ---catg-----------aagacag------ggg----------------
A0A8B9Y453_BAX-06       ---catg-----------aagacag------ggg----------------
A0A8B9Y453_BAX-01       taacatg-----------ca-actg------cgg------------gcct
A0A8B9Y453_BAX-02       cagaagg-----------cagagtc------cggttgcctggcctcgcct
A0A8B9YH53_BAK1-01      tcagaggagcaggtagcccgggacaccgaggaggtcttccgcagctacgt
A0A8B9YH53_BAK1-02      tcagaggagcaggtagcccgggacaccgaggaggtcttccgcagctacgt
A0A8B9W5U0_BOK-01       gacaaggagctggtggcccaggcca------aggctctcggccgcgagtt
A0A8B9W5U0_BOK-02       gacaaggagctggtggcccaggcca------aggctctcggccgcgagtt
                            * *                         **                

A0A8B9Y453_BAX-03       ----------------------cccttttgcttcagg-------gtttca
A0A8B9Y453_BAX-04       ----------------------cccttttgcttcagg-------gtttca
A0A8B9Y453_BAX-05       ----------------------cccttttgcttcagg-------gtttca
A0A8B9Y453_BAX-07       ----------------------cccttttgcttcagg-------gtttca
A0A8B9Y453_BAX-06       ----------------------cccttttgcttcagg-------------
A0A8B9Y453_BAX-01       cctacac-------------ctacctctctct---gg-------gcttct
A0A8B9Y453_BAX-02       cctgcttaccattgttcccgccatctcttcctgcagg-------gcttct
A0A8B9YH53_BAK1-01      cttttac-cgccatcagcaggaacaggaggccgagggggcggctgcgcct
A0A8B9YH53_BAK1-02      cttttac-cgccatcagcaggaacaggaggccgagggggcggctgcgcct
A0A8B9W5U0_BOK-01       cgtgcacgcgcgactgctgcgcgctggcctctcctggagc----gcgccc
A0A8B9W5U0_BOK-02       cgtgcacgcgcgactgctgcgcgctggcctctcctggagc----gcgccc
                                                      *    **             

A0A8B9Y453_BAX-03       tccaggatcgagcagggcgaatggggggagagacacccgagctgggcttg
A0A8B9Y453_BAX-04       tccaggatcgagcagggcgaatggggggagagacacccgagctgggcttg
A0A8B9Y453_BAX-05       tccaggatcgagcagggcgaatggggggagagacacccgagctgggcttg
A0A8B9Y453_BAX-07       tccaggatcgagcagggcgaatggggggagagacacccgagctgggcttg
A0A8B9Y453_BAX-06       --------------------------------------------------
A0A8B9Y453_BAX-01       atttcgaccgcg------------------------acgatgtggccctg
A0A8B9Y453_BAX-02       atttcgaccgcg------------------------acgatgtggccctg
A0A8B9YH53_BAK1-01      actgacccagagatggtcaccttgcacccagaac--ctagcagcaccatg
A0A8B9YH53_BAK1-02      actgacccagagatggtcaccttgcacccagaac--ctagcagcaccatg
A0A8B9W5U0_BOK-01       gagcgcgccgcgccggtc---------------c--ccggcggccgcctg
A0A8B9W5U0_BOK-02       gagcgcgccgcgccggtc---------------c--ccggcggccgcctg
                                                                          

A0A8B9Y453_BAX-03       gagcaggtgccccag--gat------gcatccaccaag-----aagctga
A0A8B9Y453_BAX-04       gagcaggtgccccag--gat------gcatccaccaag-----aagctga
A0A8B9Y453_BAX-05       gagcaggtgccccag--gat------gcatccaccaag-----aagctga
A0A8B9Y453_BAX-07       gagcaggtgccccag--gat------gcatccaccaag-----aagctga
A0A8B9Y453_BAX-06       --------------------------------------------------
A0A8B9Y453_BAX-01       gagggtgtgggtcac--ttttttcgcgaattggccaag-----gagaagc
A0A8B9Y453_BAX-02       gagggtgtgggtcac--ttttttcgcgaattggccaag-----gagaagc
A0A8B9YH53_BAK1-01      gggcaggtgggccgccagctcgccgt-catcggggacgacatcaaccggc
A0A8B9YH53_BAK1-02      gggcaggtgggccgccagctcgccgt-catcggggacgacatcaaccggc
A0A8B9W5U0_BOK-01       gcggaggtgtg-cgccgtgctgctgcgcctggcggacg-----agctgga
A0A8B9W5U0_BOK-02       gcggaggtgtg-cgccgtgctgctgcgcctggcggacg-----agctgga
                                                                          

A0A8B9Y453_BAX-03       gcgagtgtctga------agcgcatcggagatgaattggacagtaacatg
A0A8B9Y453_BAX-04       gcgagtgtctga------agcgcatcggagatgaattggacagtaacatg
A0A8B9Y453_BAX-05       gcgagtgtctga------agcgcatcggagatgaattggacagtaacatg
A0A8B9Y453_BAX-07       gcgagtgtctga------agcgcatcggagatgaattggacagtaacatg
A0A8B9Y453_BAX-06       --------------------------------------------------
A0A8B9Y453_BAX-01       gcgagggcgcgg------agcgtctct---------------------tg
A0A8B9Y453_BAX-02       gcgagggcgcgg------agcgtctct---------------------tg
A0A8B9YH53_BAK1-01      gctatgatgcggagttccaggccat--------------gctgcagca--
A0A8B9YH53_BAK1-02      gctatgatgcggagttccaggccat--------------gctgcagca--
A0A8B9W5U0_BOK-01       gc--tgatccgg---cccagtgtct--------------accgcaacgtg
A0A8B9W5U0_BOK-02       gc--tgatccgg---cccagtgtct--------------accgcaacgtg
                                                                          

A0A8B9Y453_BAX-03       gagctgcagaggatgatcgcagctgtggacacagactc--------tccc
A0A8B9Y453_BAX-04       gagctgcagaggatgatcgcagctgtggacacagactc--------tccc
A0A8B9Y453_BAX-05       gagctgcagaggatgatcgcagctgtggacacagactc--------tccc
A0A8B9Y453_BAX-07       gagctgcagaggatgatcgcagctgtggacacagactc--------tccc
A0A8B9Y453_BAX-06       ----------ggatgatcgcagctgtggacacagactc--------tccc
A0A8B9Y453_BAX-01       aaactgcaaa-----accagcgtggcggccgcgccctc--------ttcc
A0A8B9Y453_BAX-02       aaactgcaaa-----accagcgtggcggccgcgccctc--------ttcc
A0A8B9YH53_BAK1-01      --cctgcagccaa---------cagcagacaacgcctatgagtacttcac
A0A8B9YH53_BAK1-02      --cctgcagccaa---------cagcagacaacgcctatgagtacttcac
A0A8B9W5U0_BOK-01       gcccgccagctgaacctctcc-ctgcagtcggagaccgtgg-----tgac
A0A8B9W5U0_BOK-02       gcccgccagctgaacctctcc-ctgcagtcggagaccgtgg-----tgac
                                                *  * *     *          *  *

A0A8B9Y453_BAX-03       cg----------aga-ggtctttttccgagtggcg--gctgaaatgtttt
A0A8B9Y453_BAX-04       cg----------aga-ggtctttttccgagtggcg--gctgaaatgtttt
A0A8B9Y453_BAX-05       cg----------aga-ggtctttttccgagtggcg--gctgaaatgtttt
A0A8B9Y453_BAX-07       cg----------aga-ggtctttttccgagtggcg--gctgaaatgtttt
A0A8B9Y453_BAX-06       cg----------aga-ggtctttttccgagtggcg--gctgaaatgtttt
A0A8B9Y453_BAX-01       tggacgtgcagaagc-catctcaagatgagtgg-----------------
A0A8B9Y453_BAX-02       tggacgtgc---agc-catctcaagatgagtgg-----------------
A0A8B9YH53_BAK1-01      ca----------agatcgcgtccaggccagcagcagcacccacagcctgt
A0A8B9YH53_BAK1-02      ca----------agatcgcgtc--------------------cagcctgt
A0A8B9W5U0_BOK-01       cg----------a---cgccttcctggctgtggcg--acccagatctttt
A0A8B9W5U0_BOK-02       cg----------a---cgccttcctggctgtggcg--acccagatctttt
                                    *       *                             

A0A8B9Y453_BAX-03       ccgacggcaacttcaactggggccg----ggttgtcgcccttttctactt
A0A8B9Y453_BAX-04       ccgacggcaacttcaactggggccg----ggttgtcgcccttttctactt
A0A8B9Y453_BAX-05       ccgacggcaacttcaactggggccg----ggttgtcgcccttttctactt
A0A8B9Y453_BAX-07       ccgacggcaacttcaactggggccg----ggttgtcgcccttttctactt
A0A8B9Y453_BAX-06       ccgacggcaacttcaactggggccg----ggttgtcgcccttttctactt
A0A8B9Y453_BAX-01       -----ggtaa----aacccaggacgctatggaggccgcccttctc-----
A0A8B9Y453_BAX-02       -----ggtaa----aacccaggacgctatggaggccgcccttctc-----
A0A8B9YH53_BAK1-01      ttgagagcggtatcaactggggccg----cgtggtggctctgctgggctt
A0A8B9YH53_BAK1-02      ttgagagcggtatcaactggggccg----cgtggtggctctgctgggctt
A0A8B9W5U0_BOK-01       ctgca---ggtatcacgtggggcaa----agttgtgtccctg-tactccg
A0A8B9W5U0_BOK-02       ctgca---ggtatcacgtggggcaa----agttgtgtccctg-tactccg
                                      *     **        *  *   * **  *      

A0A8B9Y453_BAX-03       tgccagc-aaactggtgctcaa------------ggccctgtgcaccaag
A0A8B9Y453_BAX-04       tgccagc-aaactggtgctcaa------------ggccctgtgcaccaag
A0A8B9Y453_BAX-05       tgccagc-aaactggtgctcaa------------ggccctgtgcaccaag
A0A8B9Y453_BAX-07       tgccagc-aaactggtgctcaa------------ggccctgtgcaccaag
A0A8B9Y453_BAX-06       tgccagc-aaactggtgctcaa------------ggccctgtgcaccaag
A0A8B9Y453_BAX-01       --------------gtagagaa------------gaacc--tgaatcaa-
A0A8B9Y453_BAX-02       --------------gtagagaa------------gaacc--tgaatcaa-
A0A8B9YH53_BAK1-01      tggctac-cgcctggccctccac-----------------gtctacca--
A0A8B9YH53_BAK1-02      tggctac-cgcctggccctccac-----------------gtctacca--
A0A8B9W5U0_BOK-01       tggccgc-gggctggccgtggactgt-------------agccttccagg
A0A8B9W5U0_BOK-02       tggccgcggggctggccgtggactgtgtgcggcaggcccagcccgccctg
                                      *      *                        *   

A0A8B9Y453_BAX-03       gtgcccgagttgatcaggaccatcatgggctggacattg--------gac
A0A8B9Y453_BAX-04       gtgcccgagttgatcaggaccatcatgggctggacattg--------gac
A0A8B9Y453_BAX-05       gtgcccgagttgatcaggaccatcatgggctggacattg--------gac
A0A8B9Y453_BAX-07       gtgcccgagttgatcaggaccatcatgggctggacattg--------gac
A0A8B9Y453_BAX-06       gtgcccgagttgatcaggaccatcatgggctggacattg--------gac
A0A8B9Y453_BAX-01       --gccctgttggatctg------catggcctggcttctgcccgcggagac
A0A8B9Y453_BAX-02       --gccctgttggatctg------catggcctggcttctgcccgcggagac
A0A8B9YH53_BAK1-01      --g--------------------cgtggcctga-----------------
A0A8B9YH53_BAK1-02      --g--------------------cgtggcctgaccggcttcctgggccag
A0A8B9W5U0_BOK-01       -----------------------------ctcctcaa---tccatgggat
A0A8B9W5U0_BOK-02       gtg--------------------cacgccctcgtcgactgtctcggggag
                                                     **                   

A0A8B9Y453_BAX-03       ttcc---ttcgagagcggctgctgggctggatccaggaccagggtggttg
A0A8B9Y453_BAX-04       ttcc---ttcgagagcggctgctgggctggatccaggaccagggtggttg
A0A8B9Y453_BAX-05       ttcc---ttcgagagcggctgctgggctggatccaggaccagggtggttg
A0A8B9Y453_BAX-07       ttcc---ttcgagagcggctgctgggctggatccaggaccagggtggttg
A0A8B9Y453_BAX-06       ttcc---ttcgagagcggctgctgggctggatccaggaccagggtggttg
A0A8B9Y453_BAX-01       ccccacatctgtgacttcctggagaaccacttcctagatgagga------
A0A8B9Y453_BAX-02       ccccacatctgtgacttcctggagaaccacttcctagatgagga------
A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      gtga---cccgcttcgtggccgacttcatgctgcgtcgctccatcgcccg
A0A8B9W5U0_BOK-01       tttc---caggcaaga----------------------------------
A0A8B9W5U0_BOK-02       tttg---tgcggaagacgctggcaacctggctgcggaggcgtggtggatg
                                                                          

A0A8B9Y453_BAX-03       g----------tcgca---accttcggagtcagccactcagctgtc-cgc
A0A8B9Y453_BAX-04       g----------tcgca---accttcggagtcagccactcagctgtc-cgc
A0A8B9Y453_BAX-05       ggacggcctcctctcc---tactttgg-gacacccacatggcagac-agt
A0A8B9Y453_BAX-07       ggacggcctcctctcc---tactttgg-gacacccacatggcagac-agt
A0A8B9Y453_BAX-06       ggacggcctcctctcc---tactttgg-gacacccacatggcagac-agt
A0A8B9Y453_BAX-01       -------------------------agtgaaactcatcaagaagatgggt
A0A8B9Y453_BAX-02       -------------------------agtgaaactcatcaagaagatgggt
A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      gtggatcgcgcagaggggtggctgggtggcagccctggacttggggaacg
A0A8B9W5U0_BOK-01       -------gtactggag------tggggtgccattgtcttctc-------c
A0A8B9W5U0_BOK-02       gacggacgtgctcaag------tgcgtggtcagcaccgacccgggcctgc
                                                                          

A0A8B9Y453_BAX-03       gatcaccgggaccagccaccattttttaactccttattattaccgaccaa
A0A8B9Y453_BAX-04       gatcaccgggaccagccaccattttttaactccttattattaccgaccaa
A0A8B9Y453_BAX-05       gaccatc---------------tttgtggc--------------------
A0A8B9Y453_BAX-07       gaccatc---------------tttgtggc--------------------
A0A8B9Y453_BAX-06       gaccatc---------------tttgtggc--------------------
A0A8B9Y453_BAX-01       gaccacc-------------------tgac--------------------
A0A8B9Y453_BAX-02       gaccacc-------------------tgac--------------------
A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      gccccat-----------caagagcgtagc--------------------
A0A8B9W5U0_BOK-01       gtctgct-----------ttattgagta----------------------
A0A8B9W5U0_BOK-02       gctcgca-----------ctggctggtggc--------------------
                                                                          

A0A8B9Y453_BAX-03       tcatgagctcccagattcgtcagaattattctaccgaggtggaggccgcc
A0A8B9Y453_BAX-04       tcatgagctcccagattcgtcagaattattctaccgaggtggaggccgcc
A0A8B9Y453_BAX-05       ---------------------------------------tggag-----t
A0A8B9Y453_BAX-07       ---------------------------------------tggag-----t
A0A8B9Y453_BAX-06       ---------------------------------------tggag-----t
A0A8B9Y453_BAX-01       ----------------------------------------------caac
A0A8B9Y453_BAX-02       ----------------------------------------------caac
A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      -------------------------------------------------c
A0A8B9W5U0_BOK-01       -------------------------------------------------c
A0A8B9W5U0_BOK-02       -------------------------------------------------c
                                                                          

A0A8B9Y453_BAX-03       gtcaaccgcctggttaacatgcaactgcgggcctcctacacctacctctc
A0A8B9Y453_BAX-04       gtcaaccgcctggttaacatgcaactgcgggcctcctacacctacctctc
A0A8B9Y453_BAX-05       gctcaccgcctcgct------------------------------cacca
A0A8B9Y453_BAX-07       gctcaccgcctcgct------------------------------cacca
A0A8B9Y453_BAX-06       gctcaccgcctcgct------------------------------cacca
A0A8B9Y453_BAX-01       ctccgcaggctggct------------------------------ggtcc
A0A8B9Y453_BAX-02       ctccgcaggctggct------------------------------ggtcc
A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      ---------atcgtt------------------------------ctggc
A0A8B9W5U0_BOK-01       gcctattgtattatt------------------------------agtat
A0A8B9W5U0_BOK-02       gcgctctgcagcttt------------------------------gg---
                                                                          

A0A8B9Y453_BAX-03       tctggtgaggttccccaagacgcccccagcccaagtttccctcagctgcg
A0A8B9Y453_BAX-04       tctggtgaggttccccaagacgcccccagcccaagtttccctcagctgcg
A0A8B9Y453_BAX-05       tctgg-----------aagaag----------------------------
A0A8B9Y453_BAX-07       tctgg-----------aagaag----------------------------
A0A8B9Y453_BAX-06       tctgg-----------aagaag----------------------------
A0A8B9Y453_BAX-01       ccaggctgggttgggcgagtatctcttcgaaaggctcaccctcaagcacg
A0A8B9Y453_BAX-02       ccaggctgggttgggcgagtatctcttcgaaaggctcaccctcaagcacg
A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      tgtggttttgttgggccagttt---gtggtacgaagattcttcaagtca-
A0A8B9W5U0_BOK-01       ttttactttgtgaatccactattcatttgtgttcccatttcttcagaaac
A0A8B9W5U0_BOK-02       --ccgcttcctgaaggcagccttc-ttcatg---ctgttgccggagaga-
                                                                          

A0A8B9Y453_BAX-03       cacctcaggccctctgcgcacgcgctggccttctttgtccccttcgatag
A0A8B9Y453_BAX-04       cacctcaggccctctgcgcacgcgctggccttctttgtccccttcgatag
A0A8B9Y453_BAX-05       -------------------atgggctga----------------------
A0A8B9Y453_BAX-07       -------------------atgggctga----------------------
A0A8B9Y453_BAX-06       -------------------atgggctga----------------------
A0A8B9Y453_BAX-01       -----------------------actag----------------------
A0A8B9Y453_BAX-02       -----------------------actag----------------------
A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      -------------------------tga----------------------
A0A8B9W5U0_BOK-01       t----------------------gttga----------------------
A0A8B9W5U0_BOK-02       -------------------------tga----------------------
                                                                          

© 1998-2023Legal notice