Dataset for CDS BCL-2-like of organism Sphenodon punctatus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8D0G5J1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sphenodon punctatus GN=MCL-1 (length=1140 residues).
atgttagcgatgaagcgaagcgcggtgatcggactcaatctctactgcgggggcggcccggccttggctccggcttcgcc
cgcgtctccggggggcggcggcggcgcccctcccgcctcggcctcccccaacggcccggctgaggcggggggcgcgcggc
cgccgctgattggcggagccccctgggcccctcgcgacccctcggccgagccgcgcgctctgattggcggggcgctgccg
cgcgagggtcccccggctgaggagccccgcgctctgattggcaggggggccccggccgaggcgccccgcgtcctgattgg
cggcggcggcagcggcgggccccggccggcctcgctctggcacccggaggacgagctggacggctgcgacccggagctgc
ggcgcggggccccggacggctccagcgacgccgagtccccgccgggcaccccgatgccggaggggggccccggccagggc
tcggcctcgggcccggacctgctcgcccaggagtcgctggagctgatcgggcgctacctgcgcgaggcggccggggccag
cccgcccggcggctccaagctgctcaaggggctgctggggcggccgcgcggcgagacccagcgggcgctggagaccctgc
ggcgcgtcggggacagcgtcctccagaaccaccggctcgccttccaggggatgcttaggaagctgaatatcaagaatgaa
gatgatctgaagtctgtgtcagaagttgcaacccatgttttcagtgatggggtaacaaactggggtagaattgtgactct
catctcttttggtgcctttgttgcaaaacacctgaaaagcctaaaccaggagaactgcattgataggctagcagagatca
tcacagatgtgctcataacagacaagcgggaatggctggtcaaccaacgagcttgggagggatttgttgaattcttccac
gtagaggacctagaaagcagcatcagaagtgttctgatggcttttgcgggtgtggctggattgggcgcaagcttggcata
catgatgcggtgtttaagtggagaaactgcattctgcttccttgaggagcatcatgaaaggaagcagaggacaacttcaa
agagaagttcttttccctaa
>gnl|bcl2dbcds|A0A8D0H8G3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL2A1 (length=528 residues).
atggagagctatgagttccgttatgtgcacggtttggtccaagattatttgaaatatatccttcacgaaccgcaggtcgg
aacagctccaagcaaagcctcacaggtcttaagaaatgttgcagcctctcatcagaagaaagttgaagagagcttaagac
cgtatttagacaacctggctattcactctgtggatgctgcccggatcattttcaatcaagtcatggaaaaagaatttgat
gatgggaacaccaactggggacggattttgacagtatttatgtttggaggaatcctctctaagaagctaaaggaacttgg
agtccagctgactggtgaaatggaagagcagatttcttgcttcatcactgaatacatcataaggaccaaagctgactgga
tagaagagaacggaggctgggaaaatggctttgtggcaaagtttgaggagaaaagtccctggctgtccttatttgacatt
aagacaaaattcatggctatcttttcgttcttcaaccagtattattga
>gnl|bcl2dbcds|A0A8D0HVA8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL2L1 (length=690 residues).
atgttgagtggcaaccgagcgctagtcgttgactttatatcctacaagctgtcgcagaggggctacagctggagccagct
cgaagggcacgatgagaacaggactgagacggtagaaggggcagcgatggggagtgtgcctaatgggagcccatcctggc
atcccagtgccagtcccatagtgaacggggctgctgggcacaccaacggcgtggaagcccacgaagggctcacagtggtg
gacgtgaggcaggcgctgagagaggcaggggaggagtttgaactccgataccggagggcgttcagtgacctcacctccca
gctccacatcacccccgtcacggcgtaccagagcttcgagcaagtggtgaacgaactctttcgggatggagtgaactggg
ggcgcatcgtggcttttttctcctttggaggggccctgtgcgtggagagcgtcgacaaggagatgcaggggctggtggga
cgcatcgtcacctggatggccacttacctgactgaccatctagatccctggatccaggagaatggcggctgggagaggtt
tgtcgatctctacgggaacgacgctgcagccaagagcaggaaaggccaggaacgcttcaacaagtggcttctgactgggg
ccaccgtggcaggcgtcgtcctcctgggctccctcttgagccgcaaataa
>gnl|bcl2dbcds|A0A8D0HVA8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL2L1 (length=690 residues).
atgttgagtggcaaccgagcgctagtcgttgactttatatcctacaagctgtcgcagaggggctacagctggagccagct
cgaagggcacgatgagaacaggactgagacggtagaaggggcagcgatggggagtgtgcctaatgggagcccatcctggc
atcccagtgccagtcccatagtgaacggggctgctgggcacaccaacggcgtggaagcccacgaagggctcacagtggtg
gacgtgaggcaggcgctgagagaggcaggggaggagtttgaactccgataccggagggcgttcagtgacctcacctccca
gctccacatcacccccgtcacggcgtaccagagcttcgagcaagtggtgaacgaactctttcgggatggagtgaactggg
ggcgcatcgtggcttttttctcctttggaggggccctgtgcgtggagagcgtcgacaaggagatgcaggggctggtggga
cgcatcgtcacctggatggccacttacctgactgaccatctagatccctggatccaggagaatggcggctgggagaggtt
tgtcgatctctacgggaacgacgctgcagccaagagcaggaaaggccaggaacgcttcaacaagtggcttctgactgggg
ccaccgtggcaggcgtcgtcctcctgggctccctcttgagccgcaaataa
>gnl|bcl2dbcds|A0A8D0HVA8_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL2L1 (length=690 residues).
atgttgagtggcaaccgagcgctagtcgttgactttatatcctacaagctgtcgcagaggggctacagctggagccagct
cgaagggcacgatgagaacaggactgagacggtagaaggggcagcgatggggagtgtgcctaatgggagcccatcctggc
atcccagtgccagtcccatagtgaacggggctgctgggcacaccaacggcgtggaagcccacgaagggctcacagtggtg
gacgtgaggcaggcgctgagagaggcaggggaggagtttgaactccgataccggagggcgttcagtgacctcacctccca
gctccacatcacccccgtcacggcgtaccagagcttcgagcaagtggtgaacgaactctttcgggatggagtgaactggg
ggcgcatcgtggcttttttctcctttggaggggccctgtgcgtggagagcgtcgacaaggagatgcaggggctggtggga
cgcatcgtcacctggatggccacttacctgactgaccatctagatccctggatccaggagaatggcggctgggagaggtt
tgtcgatctctacgggaacgacgctgcagccaagagcaggaaaggccaggaacgcttcaacaagtggcttctgactgggg
ccaccgtggcaggcgtcgtcctcctgggctccctcttgagccgcaaataa
>gnl|bcl2dbcds|A0A8D0L5Z6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL-2 (length=654 residues).
atggctcatcctgggagaagaagctatgataacagggagatagtgctgaggtacatccattacaaactgtcacagagagg
atatgactgggcttccagcagagatggagcaagtgtcccttctgctgctacgggcacttcctctgaccatggtgggctgg
tgtctttgccccctgagcctcctggctcagctgctgctaataatgtgccctctgatgatgcactaaacccagtactacag
gctgttcacctgactctctgccatgctggtgacgaagtttcccgccgataccagagggatttttcccagatggctggccg
gttgcttttgatcccttttgctgccagggagagctttatggaagtggcagaagagctgttccgagatggggttaactggg
ggaggatcgtggccttccttgaatttggtggcatgatgtgtgtggagagtgttaaccgggagatgtcaccccttgtggac
agcattgctgtatggatgaccgagtacctgaacagacacctgcacaactggatcgaggacaatggaggctgggtatgtgg
ctatatgcatatgcagcctattgtatgcatttggtttatgcaagttaaaatattacagtacttagtttttattatcacat
catcatgtagttag
© 1998-2023Legal notice