Dataset for CDS BCL-2-like of organism Sphenodon punctatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D0H8G3_BCL2A1-      atggagagctatgagttcc---gttatgtgcacggtttggtccaagatta
A0A8D0HVA8_BCL2L1-      atg-------ttgagtggc-----------aaccgagcgctagtcg----
A0A8D0HVA8_BCL2L1-      atg-------ttgagtggc-----------aaccgagcgctagtcg----
A0A8D0HVA8_BCL2L1-      atg-------ttgagtggc-----------aaccgagcgctagtcg----
A0A8D0G5J1_MCL1-01      atg--------ttagcgatgaagcga----agcgcggtgatcggac----
A0A8D0L5Z6_BCL2-01      atggctcatcctgggagaagaagctatgataacagggagatagtgc----
                        ***        *  *                 *     * *         

A0A8D0H8G3_BCL2A1-      tttgaaatatatccttcacgaa----------------------------
A0A8D0HVA8_BCL2L1-      --ttgactttatatcctacaag----------------------------
A0A8D0HVA8_BCL2L1-      --ttgactttatatcctacaag----------------------------
A0A8D0HVA8_BCL2L1-      --ttgactttatatcctacaag----------------------------
A0A8D0G5J1_MCL1-01      --tca---atctctactgcgggggcggcccggccttggctccggcttcgc
A0A8D0L5Z6_BCL2-01      --tgaggtacatccattacaaa----------------------------
                          *        *      *                               

A0A8D0H8G3_BCL2A1-      -----ccgcaggtcgga-acagct--------------------------
A0A8D0HVA8_BCL2L1-      --ctgtcgcagaggggctacagctggagccagctcgaagggcacgatgag
A0A8D0HVA8_BCL2L1-      --ctgtcgcagaggggctacagctggagccagctcgaagggcacgatgag
A0A8D0HVA8_BCL2L1-      --ctgtcgcagaggggctacagctggagccagctcgaagggcacgatgag
A0A8D0G5J1_MCL1-01      ccgcgtctccggggggcggcggcggcgcccctcccgcctcggcctccccc
A0A8D0L5Z6_BCL2-01      --ctgtcacagagaggatatgactgggct---------------------
                              * * *   **      *                           

A0A8D0H8G3_BCL2A1-      -----ccaagcaaa----------------------------------gc
A0A8D0HVA8_BCL2L1-      aacag---gactgagacggtagaaggggcagcgatggggagtgt----gc
A0A8D0HVA8_BCL2L1-      aacag---gactgagacggtagaaggggcagcgatggggagtgt----gc
A0A8D0HVA8_BCL2L1-      aacag---gactgagacggtagaaggggcagcgatggggagtgt----gc
A0A8D0G5J1_MCL1-01      aacggcccggctgaggcggggggcgcgcggccgccgctgattggcggagc
A0A8D0L5Z6_BCL2-01      -----tccagcagagatggagcaagtgtcccttctgctg-----------
                                  *  *                                    

A0A8D0H8G3_BCL2A1-      ctcacaggtc-------------------------------------tta
A0A8D0HVA8_BCL2L1-      ctaatgggagccc------------------------------atcctgg
A0A8D0HVA8_BCL2L1-      ctaatgggagccc------------------------------atcctgg
A0A8D0HVA8_BCL2L1-      ctaatgggagccc------------------------------atcctgg
A0A8D0G5J1_MCL1-01      cccctgggcccctcgcgacccctcggccgagccgcgcgctctgat--tgg
A0A8D0L5Z6_BCL2-01      -ctacgggcacttc------------------------ctctgaccatgg
                              **                                       *  

A0A8D0H8G3_BCL2A1-      agaaatgttgca--------------------------------------
A0A8D0HVA8_BCL2L1-      catcccagtgcca-------------------------------------
A0A8D0HVA8_BCL2L1-      catcccagtgcca-------------------------------------
A0A8D0HVA8_BCL2L1-      catcccagtgcca-------------------------------------
A0A8D0G5J1_MCL1-01      cggggcgctgccgcgcgagggtcccccggctgaggagccccgcgctctga
A0A8D0L5Z6_BCL2-01      tgggctggtgt--------------------------ctttgccccctga
                                **                                        

A0A8D0H8G3_BCL2A1-      ------------------------------gcctctcatcagaagaaagt
A0A8D0HVA8_BCL2L1-      ------------------------------gtcccatagtgaacgg-ggc
A0A8D0HVA8_BCL2L1-      ------------------------------gtcccatagtgaacgg-ggc
A0A8D0HVA8_BCL2L1-      ------------------------------gtcccatagtgaacgg-ggc
A0A8D0G5J1_MCL1-01      ttggcaggggggccccggccgaggcgccccgcgtcctgattggcggcggc
A0A8D0L5Z6_BCL2-01      ------------------------------gcctcctggct--cagctgc
                                                      *   *             * 

A0A8D0H8G3_BCL2A1-      tga----agagagctta---agaccgtatttagacaacctggctattcac
A0A8D0HVA8_BCL2L1-      tgc------tgggcaca--ccaacggcgtggaagcccacgaagggctcac
A0A8D0HVA8_BCL2L1-      tgc------tgggcaca--ccaacggcgtggaagcccacgaagggctcac
A0A8D0HVA8_BCL2L1-      tgc------tgggcaca--ccaacggcgtggaagcccacgaagggctcac
A0A8D0G5J1_MCL1-01      ggc-agcggcgggccccggccggcctcgctctggcacccggaggacgagc
A0A8D0L5Z6_BCL2-01      tgctaataatgtgccct--ctgatgatgcactaaacccagtactacaggc
                         *        * **                                   *

A0A8D0H8G3_BCL2A1-      ----------------------------------------------tctg
A0A8D0HVA8_BCL2L1-      agtggtggacgtgaggcaggcgctgagagagg---------------cag
A0A8D0HVA8_BCL2L1-      agtggtggacgtgaggcaggcgctgagagagg---------------cag
A0A8D0HVA8_BCL2L1-      agtggtggacgtgaggcaggcgctgagagagg---------------cag
A0A8D0G5J1_MCL1-01      --tggacggctgcgacccggagctgcggcgcggggccccggacggctcca
A0A8D0L5Z6_BCL2-01      --tgttc-------acctgactctctgccatg---------------ctg
                                                                       *  

A0A8D0H8G3_BCL2A1-      tggatg--------------------------------------------
A0A8D0HVA8_BCL2L1-      gggagg---agttt-------gaactccgataccggaggg----------
A0A8D0HVA8_BCL2L1-      gggagg---agttt-------gaactccgataccggaggg----------
A0A8D0HVA8_BCL2L1-      gggagg---agttt-------gaactccgataccggaggg----------
A0A8D0G5J1_MCL1-01      gcgacgccgagtccccgccgggcaccccgatgccggaggggggccccggc
A0A8D0L5Z6_BCL2-01      gtgacg--aagtttcc--------cgccgataccagaggga---------
                          ** *                                            

A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      -------------cgttcagtgacctcacctccca---------------
A0A8D0HVA8_BCL2L1-      -------------cgttcagtgacctcacctccca---------------
A0A8D0HVA8_BCL2L1-      -------------cgttcagtgacctcacctccca---------------
A0A8D0G5J1_MCL1-01      cagggctcggcctcgggcccggacctgctcgcccaggagtcgctggagct
A0A8D0L5Z6_BCL2-01      --------------------------tttttcccagatg--------gct
                                                                          

A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------gct---------------------------------------
A0A8D0HVA8_BCL2L1-      --------gct---------------------------------------
A0A8D0HVA8_BCL2L1-      --------gct---------------------------------------
A0A8D0G5J1_MCL1-01      gatcgggcgctacctgcgcgaggcggccggggccagcccgcccggcggct
A0A8D0L5Z6_BCL2-01      ggccggttgct---------------------------------------
                                                                          

A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0G5J1_MCL1-01      ccaagctgctcaaggggctgctggggcggccgcgcggcgagacccagcgg
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
                                                                          

A0A8D0H8G3_BCL2A1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      ---ccacatcacccccgtcacggcg-------------------------
A0A8D0HVA8_BCL2L1-      ---ccacatcacccccgtcacggcg-------------------------
A0A8D0HVA8_BCL2L1-      ---ccacatcacccccgtcacggcg-------------------------
A0A8D0G5J1_MCL1-01      gcgctggagaccctgcggcgcgtcggggacagcgtcctccagaaccaccg
A0A8D0L5Z6_BCL2-01      ---tttgatcccttttg---------------------------------
                                                                          

A0A8D0H8G3_BCL2A1-      ------ctgcccggatcatttt-----------caatcaagtcatggaaa
A0A8D0HVA8_BCL2L1-      -------taccag----agctt-----------cgagcaagtggtgaacg
A0A8D0HVA8_BCL2L1-      -------taccag----agctt-----------cgagcaagtggtgaacg
A0A8D0HVA8_BCL2L1-      -------taccag----agctt-----------cgagcaagtggtgaacg
A0A8D0G5J1_MCL1-01      gctcgccttccaggggatgcttaggaagctgaatatcaagaatgaagatg
A0A8D0L5Z6_BCL2-01      ------ctgccagggagagctt-----------tatggaagtggcagaag
                               * ** *       **                *        *  

A0A8D0H8G3_BCL2A1-      aagaa------------------------------tttgatgatgggaac
A0A8D0HVA8_BCL2L1-      aactc------------------------------tttcgggatggagt-
A0A8D0HVA8_BCL2L1-      aactc------------------------------tttcgggatggagt-
A0A8D0HVA8_BCL2L1-      aactc------------------------------tttcgggatggagt-
A0A8D0G5J1_MCL1-01      atctgaagtctgtgtcagaagttgcaacccatgttttcagtgatggggta
A0A8D0L5Z6_BCL2-01      agctg------------------------------ttccgagatggggt-
                        *                                  **    *****    

A0A8D0H8G3_BCL2A1-      accaactggggacggattttgacagtatttatgtttggaggaatcctctc
A0A8D0HVA8_BCL2L1-      --gaactgggggcgcatcgtggcttttttctcctttggaggggccct---
A0A8D0HVA8_BCL2L1-      --gaactgggggcgcatcgtggcttttttctcctttggaggggccct---
A0A8D0HVA8_BCL2L1-      --gaactgggggcgcatcgtggcttttttctcctttggaggggccct---
A0A8D0G5J1_MCL1-01      acaaactggggtagaattgtgactctcatctcttttggtgcctttgttgc
A0A8D0L5Z6_BCL2-01      --taactgggggaggatcgtggccttccttgaatttggtggcatgat---
                           ********  * **  ** *  *  *    ***** *      *   

A0A8D0H8G3_BCL2A1-      taagaagctaaagg-----aacttgg----------------------ag
A0A8D0HVA8_BCL2L1-      ---gtgcgtggagagcgtcgacaagg----------------------ag
A0A8D0HVA8_BCL2L1-      ---gtgcgtggagagcgtcgacaagg----------------------ag
A0A8D0HVA8_BCL2L1-      ---gtgcgtggagagcgtcgacaagg----------------------ag
A0A8D0G5J1_MCL1-01      aaaacacctgaaaagcctaaaccaggagaactgcattgataggctagcag
A0A8D0L5Z6_BCL2-01      ---gtgtgtggagagtgttaaccggg----------------------ag
                                *  *        **  **                      **

A0A8D0H8G3_BCL2A1-      tccagctgactggtgaaa------tggaagagcagatttcttgcttcatc
A0A8D0HVA8_BCL2L1-      atgcaggggctggtggga------------cgc--atcgtcacctggatg
A0A8D0HVA8_BCL2L1-      atgcaggggctggtggga------------cgc--atcgtcacctggatg
A0A8D0HVA8_BCL2L1-      atgcaggggctggtggga------------cgc--atcgtcacctggatg
A0A8D0G5J1_MCL1-01      agatcatcacagatgtgctcataacagacaagc--gggaatggctggtca
A0A8D0L5Z6_BCL2-01      atgtcaccccttgtggac------------agc--attgctgtatggatg
                                 *   **                **           *     

A0A8D0H8G3_BCL2A1-      actgaatacatcataaggaccaaagctgact------------ggataga
A0A8D0HVA8_BCL2L1-      gccacttacctgactgaccatctagatccct------------ggatcca
A0A8D0HVA8_BCL2L1-      gccacttacctgactgaccatctagatccct------------ggatcca
A0A8D0HVA8_BCL2L1-      gccacttacctgactgaccatctagatccct------------ggatcca
A0A8D0G5J1_MCL1-01      accaacgagcttgggagggatttgttgaattcttccacgtagaggaccta
A0A8D0L5Z6_BCL2-01      accgagtacctgaacagacacctgcacaact------------ggatcga
                         *     *  *                   *            ***   *

A0A8D0H8G3_BCL2A1-      aga-------------------gaacggaggctgggaa-----aatggct
A0A8D0HVA8_BCL2L1-      gga-------------------gaatggcggctgggagaggtttgtcgat
A0A8D0HVA8_BCL2L1-      gga-------------------gaatggcggctgggagaggtttgtcgat
A0A8D0HVA8_BCL2L1-      gga-------------------gaatggcggctgggagaggtttgtcgat
A0A8D0G5J1_MCL1-01      gaaagcagcatcagaagtgttctgatggcttttgcggg-----tgtggct
A0A8D0L5Z6_BCL2-01      gga-------------------caatggaggctgggta-----tgtggct
                          *                     * **    ** *         * * *

A0A8D0H8G3_BCL2A1-      ttgt----------------------ggcaaagttt----gaggagaaaa
A0A8D0HVA8_BCL2L1-      ctct--------------acgggaacgacgctgcagccaagagcaggaaa
A0A8D0HVA8_BCL2L1-      ctct--------------acgggaacgacgctgcagccaagagcaggaaa
A0A8D0HVA8_BCL2L1-      ctct--------------acgggaacgacgctgcagccaagagcaggaaa
A0A8D0G5J1_MCL1-01      ggattgggcgcaagcttggcatacatgatgcggtgtttaagtggagaaac
A0A8D0L5Z6_BCL2-01      atat--------------gcatatgcagcctattgt-------------a
                           *                                              

A0A8D0H8G3_BCL2A1-      g----------------tccctggctgtccttatttgacattaagacaaa
A0A8D0HVA8_BCL2L1-      ggccaggaacgcttcaacaagtggcttctgactggggccaccgtggcagg
A0A8D0HVA8_BCL2L1-      ggccaggaacgcttcaacaagtggcttctgactggggccaccgtggcagg
A0A8D0HVA8_BCL2L1-      ggccaggaacgcttcaacaagtggcttctgactggggccaccgtggcagg
A0A8D0G5J1_MCL1-01      tg---------------cattctgcttcct-tgaggagcatcatgaaagg
A0A8D0L5Z6_BCL2-01      tg---------------catttggtttatg-caagttaaaatattacagt
                                               * *             *       *  

A0A8D0H8G3_BCL2A1-      attcat------ggctatcttttcgttcttcaaccagtattattga
A0A8D0HVA8_BCL2L1-      cgtcgtcctcctgggctccctcttgagccgcaaa---------taa
A0A8D0HVA8_BCL2L1-      cgtcgtcctcctgggctccctcttgagccgcaaa---------taa
A0A8D0HVA8_BCL2L1-      cgtcgtcctcctgggctccctcttgagccgcaaa---------taa
A0A8D0G5J1_MCL1-01      aagcag-----aggacaacttcaaag--agaagttcttttccctaa
A0A8D0L5Z6_BCL2-01      acttagtttttattatcacatcatca--tgtagt---------tag
                                          * *          *           *  

© 1998-2023Legal notice