Dataset for CDS BCL-2-like of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A076FU27_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccagagccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatatgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A076FZV9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccggagccgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A452E1B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagtttttccagaaaggatacagctggagtcagtt
tagtgatatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagcgccatcagtggca
acccatcctggcacctggcagatagctctgtggtgaatggagccactggtcacagcagaagcttggacgctgggaaaatg
atccccacggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggacaacatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggtgtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaataaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacttcaaccgctggt
ccctgacggacgtgactgtggctggtatggctctgctgggcttgctcttcaacacataa
>gnl|bcl2dbcds|A0A452ECF0_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Capra hircus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggttcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaaccgtagg
ggcctttttcgctagcaagtga
>gnl|bcl2dbcds|A0A452EK63_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Capra hircus GN=BCL2A1 (length=528 residues).
atgactgacactgagtttgactacgttcacaagctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaacatccagggtgttacaagacgtggcttcctctgtccaggacgaagtggaaaggactttgaagc
agtgcttggataagtttgatgtggtgtctgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgagcaagcg
tattgcctcagacatggacatgtgcaaggacatttcttatttcgtggcggagtttatcaccgaaaacacaggagagtgga
taaggcaaaacggaggctgggaaaatgggtttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgtctgaagcaatactattga
>gnl|bcl2dbcds|A0A452EV13_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccggagccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcctcccagccgg
gccgcgcgcccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A452FHY1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=723 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggctcgctcttcaactcatagtgactg
ttcctttcattacagtcattcatgttttgcacaagcttgtgttcccttccttttgttacagctatagagaccttacaatt
taa
>gnl|bcl2dbcds|A0A452FHY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggggatcaggactcagcaggaaggcag
ctgtctctaaagataccccttggctcaccttcccctctccccatgctcaagcctactga
>gnl|bcl2dbcds|A0A452FWV3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacattaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctatgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A452GA25_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1008 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcgcgccggcccgagccccccggccactcttg
cgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgtcaccgcgacccccaccagactg
ctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccatcatgtcgcccga
agaggagctggacgggtgcgagccagaccctctcgggaagcggcctgccgtccggcctttagctttgatggtcggagaag
ccagtaacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatcagaggaggaggaggacgagttatat
cggcagtccctggagattatctctcagtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtc
tggggccaccagccggaaggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagacggctttcc
aaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatggttcatgttttcagt
gacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaa
tcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaac
aaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttt
gcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A452GA25_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcct
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
© 1998-2020Legal notice