Dataset for CDS BCL-2-like of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452EK63_BCL2A1-      atg-----------------------------------------------
A0A452FHY1_BCL2L1-      atg-----------------------------------------------
A0A452FHY1_BCL2L1-      atg-----------------------------------------------
A0A452E1B1_BCL2L1-      atg-----------------------------------------------
A0A452FWV3_BCL2L1-      atg-----------------------------------------------
A0A452ECF0_BCL2L2-      atg----------------gcgacccca----------------------
A0A452GA25_MCL1-02      atgttcggcctcaagagaaacg----cagtaatcggactgaacctctact
A0A452GA25_MCL1-01      atgttcggcctcaagagaaacg----cagtaatcggactgaacctctact
A0A076FU27_BCL2-01      atg----------------gcg----ca---------------------c
A0A076FZV9_BCL2-01      atg----------------gcg----ca---------------------c
A0A452EV13_BCL2-01      atg----------------gcg----ca---------------------c
                        ***                                               

A0A452EK63_BCL2A1-      actgacactgagtttgactacgttcacaagctggctgaggactatctgaa
A0A452FHY1_BCL2L1-      ------------tctcagagcaaccgagagctggtggttgactttctctc
A0A452FHY1_BCL2L1-      ------------tctcagagcaaccgagagctggtggttgactttctctc
A0A452E1B1_BCL2L1-      ------------tctcagagcaaccgggaactagtggttgactttctctc
A0A452FWV3_BCL2L1-      ------------tctcagagcaaccgggagctggtggttgactttctctc
A0A452ECF0_BCL2L2-      ------gcctcagccccagacacacgggctctagtggcagactttgtggg
A0A452GA25_MCL1-02      gtgggggagccgggttaggaca-----------gggcagcggcgcttcct
A0A452GA25_MCL1-01      gtgggggagccgggttaggaca-----------gggcagcggcgcttcct
A0A076FU27_BCL2-01      gcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatcca
A0A076FZV9_BCL2-01      gcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatcca
A0A452EV13_BCL2-01      gcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatcca
                                                         *            *   

A0A452EK63_BCL2A1-      atatgtgttg----------------------------------------
A0A452FHY1_BCL2L1-      ttacaagctttcccagaaaggattcagctggag-----------------
A0A452FHY1_BCL2L1-      ttacaagctttcccagaaaggattcagctggag-----------------
A0A452E1B1_BCL2L1-      ttacaagtttttccagaaaggatacagctggagtcagtttagtgatatgg
A0A452FWV3_BCL2L1-      ttacaagctttcccagaaaggatacagctggagtcagtttagtgatgtgg
A0A452ECF0_BCL2L2-      ctataagctgaggcagaaggggtatgtttgtgga----------------
A0A452GA25_MCL1-02      ctccgggggggcggcttttggctgcggggaaggaggccacggcgc-----
A0A452GA25_MCL1-01      ctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcga
A0A076FU27_BCL2-01      ctacaagctgtcgcagcgcggctacgagt-gggatgccagagc-------
A0A076FZV9_BCL2-01      ctacaagctgtcgcagcgcggctacgagt-gggatgccggagc-------
A0A452EV13_BCL2-01      ctacaagctgtcgcagcgcggctacgagt-gggatgccggagc-------
                         *    *                                           

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      aagag-------------------------------------aacagaac
A0A452FWV3_BCL2L1-      aagag-------------------------------------aacagaac
A0A452ECF0_BCL2L2-      ------------------------------------------gctggc--
A0A452GA25_MCL1-02      ----------------------------------------gcgccggc-c
A0A452GA25_MCL1-01      gaggtagggggaggggaagccggcacggtgattggcggaagcgccggc-c
A0A076FU27_BCL2-01      -----------------------------------------cgcgggcgc
A0A076FZV9_BCL2-01      -----------------------------------------cgcgggcgc
A0A452EV13_BCL2-01      -----------------------------------------cgcgggcgc
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      -----cctcagaagggacaaaatcagatatggaaa-ccc-----------
A0A452FHY1_BCL2L1-      -----cctcagaagggacaaaatcagatatggaaa-ccc-----------
A0A452E1B1_BCL2L1-      tgagaccctagaagggacagaatcagatatggaaacccc-----------
A0A452FWV3_BCL2L1-      tgaggccccagaagggacagaatcagatatggaaacccc-----------
A0A452ECF0_BCL2L2-      -------cc---cggggagggcccagcagctgac----------------
A0A452GA25_MCL1-02      cgagccccc---c--ggccactcttgcgcccgacgcccggagggtcgcgc
A0A452GA25_MCL1-01      cgagccccc---c--ggccactcttgcgcccgacgcccggagggtcgcgc
A0A076FU27_BCL2-01      cgcgccccc---cggggccgcccccgcgccgggcatcctg----------
A0A076FZV9_BCL2-01      cgcgccccc---cggggccgctcccgcgccgggcatcctg----------
A0A452EV13_BCL2-01      cgcgccccc---cggggccgcccccgcgccgggcatcctg----------
                                                                          

A0A452EK63_BCL2A1-      ------------------------------------cagatacagcaa--
A0A452FHY1_BCL2L1-      ------------------------------------caatgccgtcaa--
A0A452FHY1_BCL2L1-      ------------------------------------caatgccgtcaa--
A0A452E1B1_BCL2L1-      ------------------------------------cagcgccatcag--
A0A452FWV3_BCL2L1-      ------------------------------------cagtgccatcaa--
A0A452ECF0_BCL2L2-      ------------------------------------ccgctacaccaa--
A0A452GA25_MCL1-02      ggccctcgcccattggcgccgagggccccgacgtcaccgcgacccccacc
A0A452GA25_MCL1-01      ggccctcgcccattggcgccgagggccccgacgtcaccgcgacccccacc
A0A076FU27_BCL2-01      ----tcctcccagccgggccgcacac----------ccgcgccctcca--
A0A076FZV9_BCL2-01      ----tcctcccagccgggccgcacac----------ccgcgccctcca--
A0A452EV13_BCL2-01      ----tcctcccagccgggccgcgcgc----------ccgcgccctcca--
                                                            *     *  *    

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      -----------------------tgccaacccatcttggc----------
A0A452FHY1_BCL2L1-      -----------------------tgccaacccatcttggc----------
A0A452E1B1_BCL2L1-      -----------------------tggcaacccatcctggc----------
A0A452FWV3_BCL2L1-      -----------------------tggcaacccatcttggc----------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A452GA25_MCL1-02      agactgctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagat
A0A452GA25_MCL1-01      agactgctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagat
A0A076FU27_BCL2-01      ggac----------------------ctccccgccgccgc----------
A0A076FZV9_BCL2-01      ggac----------------------ctccccgccgccgc----------
A0A452EV13_BCL2-01      ggac----------------------ctccccgccgccgc----------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A452GA25_MCL1-02      ggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacg
A0A452GA25_MCL1-01      ggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacg
A0A076FU27_BCL2-01      -----ccccggccgccgccgccg---------------------------
A0A076FZV9_BCL2-01      -----ccccggccgccgccgccg---------------------------
A0A452EV13_BCL2-01      -----ccccggccgccgccgccg---------------------------
                                                                          

A0A452EK63_BCL2A1-      -----------------------------cctggatccaagcc-------
A0A452FHY1_BCL2L1-      ----------------------------acctggcgcatagcc-----ct
A0A452FHY1_BCL2L1-      ----------------------------acctggcgcatagcc-----ct
A0A452E1B1_BCL2L1-      ----------------------------acctggcagatagct-----ct
A0A452FWV3_BCL2L1-      ----------------------------acctggcggatagcc-----ct
A0A452ECF0_BCL2L2-      --------------------------------gccatgcgggc-------
A0A452GA25_MCL1-02      ggtgcgagccagaccctctcgggaagcggcctgccgtccggcctttagct
A0A452GA25_MCL1-01      ggtgcgagccagaccctctcgggaagcggcctgccgtccggcctttagct
A0A076FU27_BCL2-01      ---------------------------ggcctg-cgcccagcc-------
A0A076FZV9_BCL2-01      ---------------------------ggcctg-cgcccagcc-------
A0A452EV13_BCL2-01      ---------------------------ggcctg-cgcccagcc-------
                                                        *       *         

A0A452EK63_BCL2A1-      -----aagcaaaacatccag------------------------------
A0A452FHY1_BCL2L1-      gcggtgaatggagccactggccaca-cagaa-------------gaaagt
A0A452FHY1_BCL2L1-      gcggtgaatggagccactggccaca-cagaa-------------gaaagt
A0A452E1B1_BCL2L1-      gtggtgaatggagccactggtcacagcagaagcttggacgctgggaaaat
A0A452FWV3_BCL2L1-      gcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagt
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A452GA25_MCL1-02      ttgatggtcggagaagccagtaacaacag---tccaggctcggacggctc
A0A452GA25_MCL1-01      ttgatggtcggagaagccagtaacaacag---tccaggctcggacggctc
A0A076FU27_BCL2-01      --------cggtgccacctgt------gg---tcca--------------
A0A076FZV9_BCL2-01      --------cggtgccacctgt------gg---tcca--------------
A0A452EV13_BCL2-01      --------cggtgccacctgt------gg---tcca--------------
                                                                          

A0A452EK63_BCL2A1-      ggtgttacaagacgtggcttcctctgtccaggacgaag------------
A0A452FHY1_BCL2L1-      ggt-cctgtggcaacagcacagcaagccccgagggagg------------
A0A452FHY1_BCL2L1-      ggt-cctgtggcaacagcacagcaagccccgagggagg------------
A0A452E1B1_BCL2L1-      gatccccacggcagtggtgaagcaagccctgagggagg------------
A0A452FWV3_BCL2L1-      gatccccatggcagcggtgaagcaagccctgagggagg------------
A0A452ECF0_BCL2L2-      -----------------------------------ag-------------
A0A452GA25_MCL1-02      gctgccctcgacgccgcccccatcagaggaggaggaggacgagttatatc
A0A452GA25_MCL1-01      gctgccctcgacgccgcccccatcagaggaggaggaggacgagttatatc
A0A076FU27_BCL2-01      ------cctgaccctgcgcc---------------agg------------
A0A076FZV9_BCL2-01      ------cctgaccctgcgcc---------------agg------------
A0A452EV13_BCL2-01      ------cctgaccctgcgcc---------------agg------------
                                                           *              

A0A452EK63_BCL2A1-      ---------tggaaaggacttt---------------------gaa--gc
A0A452FHY1_BCL2L1-      --------caggcagcgagttt---------------------gaactga
A0A452FHY1_BCL2L1-      --------caggcagcgagttt---------------------gaactga
A0A452E1B1_BCL2L1-      --------caagcaatgagtgt---------------------gaattga
A0A452FWV3_BCL2L1-      --------caggcgatgagttt---------------------gaactga
A0A452ECF0_BCL2L2-      --------ctggagatgagttt-------------------gagacc--c
A0A452GA25_MCL1-02      ggcagtccctggagattatctctcagtacctcctggagcaggcaaccggc
A0A452GA25_MCL1-01      ggcagtccctggagattatctctcagtacctcctggagcaggcaaccggc
A0A076FU27_BCL2-01      --------ccggcgatgacttctc---------------------tcggc
A0A076FZV9_BCL2-01      --------ccggcgatgacttctc---------------------tcggc
A0A452EV13_BCL2-01      --------ccggcgatgacttctc---------------------tcggc
                                   *     *                                

A0A452EK63_BCL2A1-      agtgcttggataagtttgatgtggtgtctgt-----------------ag
A0A452FHY1_BCL2L1-      ggcaccaacagacggtcagcgacctgacgtc------ccagct-----cc
A0A452FHY1_BCL2L1-      ggcaccaacagacggtcagcgacctgacgtc------ccagct-----cc
A0A452E1B1_BCL2L1-      ggtaccaacagacattcagcgacctgacgtc------ccagct-----cc
A0A452FWV3_BCL2L1-      ggtaccgacgggcattcagcgacctgacgtc------ccagct-----cc
A0A452ECF0_BCL2L2-      gcttccggcgcaccttctccgatctggcagc------tcagct-----gc
A0A452GA25_MCL1-02      gccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggc
A0A452GA25_MCL1-01      gccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggc
A0A076FU27_BCL2-01      gctaccgccgcgacttcgccgagatgtccag------ccagct-----gc
A0A076FZV9_BCL2-01      gctaccgccgcgacttcgccgagatgtccag------ccagct-----gc
A0A452EV13_BCL2-01      gctaccgccgcgacttcgccgagatgtccag------ccagct-----gc
                                            *    *                        

A0A452EK63_BCL2A1-      acactg--------------------------------------------
A0A452FHY1_BCL2L1-      acacca-------ccccagggacag-------------------------
A0A452FHY1_BCL2L1-      acacca-------ccccagggacag-------------------------
A0A452E1B1_BCL2L1-      acatca-------ccccagggacaa-------------------------
A0A452FWV3_BCL2L1-      acatta-------ccccagggacag-------------------------
A0A452ECF0_BCL2L2-      atgtga-------ccccgggttcgg-------------------------
A0A452GA25_MCL1-02      gttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgaga
A0A452GA25_MCL1-01      gttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgaga
A0A076FU27_BCL2-01      acctgacgcccttcaccgcg------------------------------
A0A076FZV9_BCL2-01      acctgacgcccttcaccgcg------------------------------
A0A452EV13_BCL2-01      acctgacgcccttcaccgcg------------------------------
                                                                          

A0A452EK63_BCL2A1-      -------ccagaacaatattca----------------------------
A0A452FHY1_BCL2L1-      -------catatcagagctttg----------------------------
A0A452FHY1_BCL2L1-      -------catatcagagctttg----------------------------
A0A452E1B1_BCL2L1-      -------catatcagagctttg----------------------------
A0A452FWV3_BCL2L1-      -------catatcagagctttg----------------------------
A0A452ECF0_BCL2L2-      -------cccagcagcgcttca----------------------------
A0A452GA25_MCL1-02      cggctttccaaggcatgcttcggaaactggacatcaaaaacgaagacgat
A0A452GA25_MCL1-01      cggctttccaaggcatgcttcggaaactggacatcaaaaacgaagacgat
A0A076FU27_BCL2-01      ---------aggggacgcttcg----------------------------
A0A076FZV9_BCL2-01      ---------aggggacgcttcg----------------------------
A0A452EV13_BCL2-01      ---------aggggacgcttcg----------------------------
                                          **                              

A0A452EK63_BCL2A1-      -------------accaagtgatggaaaaggaatttgaagatggcattgt
A0A452FHY1_BCL2L1-      -------------aacaggtaatgtatgagctcttctgggacggggt---
A0A452FHY1_BCL2L1-      -------------aacaggtaatgtatgagctcttctgggacggggt---
A0A452E1B1_BCL2L1-      -------------aacaggtaataaatgaactcttccaggatggggt---
A0A452FWV3_BCL2L1-      -------------aacaggtagtgaatgaactcttccgggacggggt---
A0A452ECF0_BCL2L2-      -------------cccaggtctctgatgaactcttcc---aagggggccc
A0A452GA25_MCL1-02      gtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaac
A0A452GA25_MCL1-01      gtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaac
A0A076FU27_BCL2-01      -------------ccacggtggtggaggagctcttcagggacggggt---
A0A076FZV9_BCL2-01      -------------ccacggtggtggaggagctcttcagggacggggt---
A0A452EV13_BCL2-01      -------------ccacggtggtggaggagctcttcagggacggggt---
                                          **        *    **     * **      

A0A452EK63_BCL2A1-      taactggggcaggattgtaaccatattcgcctttga------aggtattc
A0A452FHY1_BCL2L1-      gaactgggatcacactgtggcctttttctccttcag------gggggcac
A0A452FHY1_BCL2L1-      gaactgggatcacactgtggcctttttctccttcag------gggggcac
A0A452E1B1_BCL2L1-      gaactggtgtcgcaatgtggcctttttctccttcgg------tggggcac
A0A452FWV3_BCL2L1-      gaactggggtcgcattgtggcctttttctccttcgg------tggggcac
A0A452ECF0_BCL2L2-      caactggggtcgccttgtggccttctttgtctttgg------agccgcac
A0A452GA25_MCL1-02      aaactggggcaggattgtgactcttatttcttttggtgcctttgtggcca
A0A452GA25_MCL1-01      aaactggggcaggattgtgactcttatttcttttggtgcctttgtggcca
A0A076FU27_BCL2-01      gaactgggggcgcatcgtggccttctttgagttcgg------aggggtca
A0A076FZV9_BCL2-01      gaactgggggcgcatcgtggccttctttgagttcgg------aggggtca
A0A452EV13_BCL2-01      gaactgggggcgcatcgtggccttctttgagttcgg------aggggtca
                         ******         **  *  *  *    **          *      

A0A452EK63_BCL2A1-      ttaccaagaaacttctgagcaagcgtattgcctcagacatggacatgtgc
A0A452FHY1_BCL2L1-      tatgcatggaaagcgtagacaaggaga------tgcaggtattggtgagt
A0A452FHY1_BCL2L1-      tatgcatggaaagcgtagacaaggaga------tgcaggtattggtgagt
A0A452E1B1_BCL2L1-      tatgcatgaaaagcatagtcaaggaga------tgcaggtattggtaagt
A0A452FWV3_BCL2L1-      tgtgcgtggaaagcgtagacaaggaga------tgcaggtattggtgagt
A0A452ECF0_BCL2L2-      tgtgtgctgagagtgtcaacaaggaga------tggagccacttgtggga
A0A452GA25_MCL1-02      aacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaa
A0A452GA25_MCL1-01      aacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaa
A0A076FU27_BCL2-01      tatgtgtggagagcgtcaaccgggaga----tgtcg--cccctggtggac
A0A076FZV9_BCL2-01      tgtgtgtggagagcgtcaaccgggaga----tgtcg--cccctggtggac
A0A452EV13_BCL2-01      tgtgtgtggagagcgtcaaccgggaga----tgtcg--cccctggtggac
                                 *     *          *                       

A0A452EK63_BCL2A1-      aaggacatttcttatttcgtggcggagtttatcaccgaaaacacaggaga
A0A452FHY1_BCL2L1-      caggtcatgacttgg---atggccagccagctaaatgaccacctagagcc
A0A452FHY1_BCL2L1-      caggtcatgacttgg---atggccagccagctaaatgaccacctagagcc
A0A452E1B1_BCL2L1-      caggtcacgacttgg---atggccacttacctaaataaccacctagagcc
A0A452FWV3_BCL2L1-      cggatcgcaacttgg---atggctacttacctgaatgaccacctagagcc
A0A452ECF0_BCL2L2-      caagtgcaggagtgg---atggtggcctacctggagacgcggctggctga
A0A452GA25_MCL1-02      agcatcac-----ag---atgttctcgta-------aggtcaaaacgaga
A0A452GA25_MCL1-01      agcatcac-----ag---atgttctcgta-------aggtcaaaacgaga
A0A076FU27_BCL2-01      agcatcgccctgtgg---atgaccgagtacctgaaccggcacctgcacgc
A0A076FZV9_BCL2-01      agcatcgccctgtgg---atgaccgagtacctgaaccggcacctgcacgc
A0A452EV13_BCL2-01      agcatcgccctgtgg---atgaccgagtacctgaaccggcacctgcacgc
                                           **                             

A0A452EK63_BCL2A1-      gtggataaggcaaaacggaggctgggaaaatgggtttgtaaagaagtttg
A0A452FHY1_BCL2L1-      ttggatccaggagaatggcggctggg---acacttctgtggaattctgtg
A0A452FHY1_BCL2L1-      ttggatccaggagaatggcggctggg---acacttctgtggaattctgtg
A0A452E1B1_BCL2L1-      ttggatccaggagaatggcgactggg---acatttttgtggaactctacg
A0A452FWV3_BCL2L1-      ttggatccaggagaacggcggctggg---acacgtttgtggaactctatg
A0A452ECF0_BCL2L2-      ctggatccacagcagtgggggctggg---cggagttcacagctctatacg
A0A452GA25_MCL1-02      ctggatagtcaaacaaagaggctggg---atgggtttgtggagttcttcc
A0A452GA25_MCL1-01      ctggatagtcaaacaaagaggctggg---atgggtttgtggagttcttcc
A0A076FU27_BCL2-01      ctggatccaggacaacggaggctggg---acgcctttgtggagctgtac-
A0A076FZV9_BCL2-01      ctggatccaggacaacggaggctggg---acgcctttgtggagctgtac-
A0A452EV13_BCL2-01      ctggatccaggacaacggaggctggg---acgcctttgtggagctgtac-
                         *****           * * *****        *           *   

A0A452EK63_BCL2A1-      aaaccaaa-------tctgg--------------ctggctgactttt-ct
A0A452FHY1_BCL2L1-      aaaacaatacagcaaccgagagccaaaagggc--caggagcgcttcaact
A0A452FHY1_BCL2L1-      aaaacaatacagcaaccgagagccaaaagggc--caggagcgcttcaact
A0A452E1B1_BCL2L1-      aaaacaatacagcaaccgagagccaaaagggc--caagagcacttcaacc
A0A452FWV3_BCL2L1-      ggaacaacgcagcagccgagagccggaagggc--caggagcgcttcaacc
A0A452ECF0_BCL2L2-      gggacggggc-----cctggaggaggcgcggcgtctgcgggaggggaact
A0A452GA25_MCL1-02      atgtagagga-----cctagaag----gcggc----atcagaaatgtgct
A0A452GA25_MCL1-01      atgtagagga-----cctagaag----gcggc----atcagaaatgtgct
A0A076FU27_BCL2-01      -------ggc-----cctagcat----gcggcccctgtttgatttctcct
A0A076FZV9_BCL2-01      -------ggc-----cctagcat----gcggcccctgtttgatttctcct
A0A452EV13_BCL2-01      -------ggc-----cctagcat----gcggcccctgtttgatttctcct
                                        *  *                            * 

A0A452EK63_BCL2A1-      ggaagttacaggaaagatctgtgaaacattatgtcg--------------
A0A452FHY1_BCL2L1-      gctggtccctgacggctgtgactttggctgggctcgctcttcaactcata
A0A452FHY1_BCL2L1-      gctggtccctgacggctgtgactttggctggg---ggatcaggactcagc
A0A452E1B1_BCL2L1-      gctggtccctgacggacgtgactgtggctggtatggctctg---------
A0A452FWV3_BCL2L1-      gctggttcctgacgggcatgactgtggctggtgtggttctg---------
A0A452ECF0_BCL2L2-      gggcctcagtgaggacagtgctgacgggggctgtggcactgggggccctg
A0A452GA25_MCL1-02      gctggcttttgcaggtgttgctggagtaggagctgg---t------ttg-
A0A452GA25_MCL1-01      gctggcttttgcaggtgttgctggagtaggagctgg---t------ttg-
A0A076FU27_BCL2-01      ggctgtctctgaaggcactgctcagtctggccctgg---tgggcgcttgc
A0A076FZV9_BCL2-01      ggctgtctctgaaggcactgctcagtctggccctgg---tgggcgcttgc
A0A452EV13_BCL2-01      ggctgtctctgaaggcactgctcagtctggccctgg---tgggcgcttgc
                        *         *                        *              

A0A452EK63_BCL2A1-      ------------------------------------------tctgaagc
A0A452FHY1_BCL2L1-      gtgactgttcctttcattacagtcattcatgttttgcacaagcttgtgtt
A0A452FHY1_BCL2L1-      aggaaggcagctgtctctaaagataccc--------------cttggctc
A0A452E1B1_BCL2L1-      ------------------------------------------ctgggctt
A0A452FWV3_BCL2L1-      ------------------------------------------ctgggctc
A0A452ECF0_BCL2L2-      gtaacc------------------------------------gtaggggc
A0A452GA25_MCL1-02      ------------------------------------------------gc
A0A452GA25_MCL1-01      ------------------------------------------------gc
A0A076FU27_BCL2-01      atcacc------------------------------------ctgggtgc
A0A076FZV9_BCL2-01      atcacc------------------------------------ctgggtgc
A0A452EV13_BCL2-01      atcacc------------------------------------ctgggtgc
                                                                          

A0A452EK63_BCL2A1-      aatactat------------------------------tga-
A0A452FHY1_BCL2L1-      cccttccttttgttaca-gctatagagaccttacaatttaa-
A0A452FHY1_BCL2L1-      accttcccctctccccatgctcaag----cctac----tga-
A0A452E1B1_BCL2L1-      gctcttca----------ac---aca------------taa-
A0A452FWV3_BCL2L1-      gctcttca----------gtcggaaa------------tga-
A0A452ECF0_BCL2L2-      ctttttcg----------ctagcaag------------tga-
A0A452GA25_MCL1-02      atatcta--------------ataag------------atag
A0A452GA25_MCL1-01      atatcta--------------ataag------------atag
A0A076FU27_BCL2-01      ctatctgg----------gccataag------------tga-
A0A076FZV9_BCL2-01      ctatctgg----------gccataag------------tga-
A0A452EV13_BCL2-01      ctatctgg----------gccataag------------tga-
                                                                * 

© 1998-2020Legal notice