Dataset for CDS BCL-2-like of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

24 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      atg-----------------------------------------------
A0A8C2PEQ8_BCL2L10      atg-----------------------------------------------
A0A8C2PEQ8_BCL2L10      atg-----------------------------------------------
A0A8C2PEQ8_BCL2L10      atg-----------------------------------------------
A0A076FU27_BCL2-01      atg----------------gcgca---------------------cgcgg
A0A076FZV9_BCL2-01      atg----------------gcgca---------------------cgcgg
A0A452EV13_BCL2-01      atg----------------gcgca---------------------cgcgg
A0A8C2N853_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A8C2N853_MCL1-02      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A8C2N853_MCL1-03      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A452GA25_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A452GA25_MCL1-02      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      atg-----------------------------------------------
A0A8C2R4Z3_BCL2L2-      atg-----------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452FHY1_BCL2L1-      atg-----------------------------------------------
A0A452FHY1_BCL2L1-      atg-----------------------------------------------
A0A452E1B1_BCL2L1-      atg-----------------------------------------------
A0A8C2NR03_BCL2L1-      atg-----------------------------------------------
A0A452FWV3_BCL2L1-      atg-----------------------------------------------
A0A8C2NR03_BCL2L1-      atg-----------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      -----tttcgccaggctccacaagcttgtgcttcagactgtcttggtcac
A0A8C2PEQ8_BCL2L10      --------------------cgagaaggggcggggcgc------------
A0A8C2PEQ8_BCL2L10      --------------------cgagaaggggcggggcgc------------
A0A8C2PEQ8_BCL2L10      --------------------cgagaaggggcggggcgc------------
A0A076FU27_BCL2-01      ggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactac
A0A076FZV9_BCL2-01      ggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactac
A0A452EV13_BCL2-01      ggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactac
A0A8C2N853_MCL1-01      gggagccgggttaggaca-----------gggcagcggcgcttcctctcc
A0A8C2N853_MCL1-02      gggagccgggttaggaca-----------gggcagcggcgcttcctctcc
A0A8C2N853_MCL1-03      gggagccgggttaggaca-----------gggcagcggcgcttcctctcc
A0A452GA25_MCL1-01      gggagccgggttaggaca-----------gggcagcggcgcttcctctcc
A0A452GA25_MCL1-02      gggagccgggttaggaca-----------gggcagcggcgcttcctctcc
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------ggctggccaaacctgaaa------------tacctccctctg
A0A8C2R4Z3_BCL2L2-      --------ggctggccaaacctgaaa------------tacctccctctg
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------tctcagagcaaccgagagctggtggttgactttctctcttac
A0A452FHY1_BCL2L1-      --------tctcagagcaaccgagagctggtggttgactttctctcttac
A0A452E1B1_BCL2L1-      --------tctcagagcaaccgggaactagtggttgactttctctcttac
A0A8C2NR03_BCL2L1-      --------tctcagagcaaccgggagctggtggttgactttctctcttac
A0A452FWV3_BCL2L1-      --------tctcagagcaaccgggagctggtggttgactttctctcttac
A0A8C2NR03_BCL2L1-      --------tctcagagcaaccgggagctggtggttgactttctctcttac
                                                                          

A0A452EK63_BCL2A1-      ---------------------------------------------atgac
A0A8C2RKE2_BCL2A1-      ttgcaggtgagcaggctcaagacgctactccccagcaaggagaagatgac
A0A8C2PEQ8_BCL2L10      -----------------------------------cggcaggcccacaa-
A0A8C2PEQ8_BCL2L10      -----------------------------------cggcaggcccacaa-
A0A8C2PEQ8_BCL2L10      -----------------------------------cggcaggcccacaa-
A0A076FU27_BCL2-01      aagctgtcg--------------------------cagcgcggctacgag
A0A076FZV9_BCL2-01      aagctgtcg--------------------------cagcgcggctacgag
A0A452EV13_BCL2-01      aagctgtcg--------------------------cagcgcggctacgag
A0A8C2N853_MCL1-01      gggggggcggcttttggctgcggggaaggaggccacggcgcggcgagagg
A0A8C2N853_MCL1-02      gggggggcggcttttggctgcggggaaggaggccacggcgcggcgagagg
A0A8C2N853_MCL1-03      gggggggcggctttt-----------------------------------
A0A452GA25_MCL1-01      gggggggcggcttttggctgcggggaaggaggccacggcgcggcgagagg
A0A452GA25_MCL1-02      gggggggcggcttttggctgcggggaaggaggccacggcgc---------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      ggcctctca--------------------------ccatatattcatgcc
A0A8C2R4Z3_BCL2L2-      ggcctctca--------------------------ccatatattcatgcc
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452FHY1_BCL2L1-      aagctttcc--------------------------cagaaaggattcagc
A0A452FHY1_BCL2L1-      aagctttcc--------------------------cagaaaggattcagc
A0A452E1B1_BCL2L1-      aagtttttc--------------------------cagaaaggatacagc
A0A8C2NR03_BCL2L1-      aagctttcc--------------------------cagaaaggatacagc
A0A452FWV3_BCL2L1-      aagctttcc--------------------------cagaaaggatacagc
A0A8C2NR03_BCL2L1-      aagctttcc--------------------------cagaaaggatacagc
                                                                          

A0A452EK63_BCL2A1-      tgacactgagtttgactacg--------ttcacaagctggctgaggacta
A0A8C2RKE2_BCL2A1-      tgacactgagtttgactacg--------ttcacaagctggctgaggacta
A0A8C2PEQ8_BCL2L10      ---------------------------------aacaggccggggtcggc
A0A8C2PEQ8_BCL2L10      ---------------------------------aacaggccggggtcggc
A0A8C2PEQ8_BCL2L10      ---------------------------------aacaggccggggtcggc
A0A076FU27_BCL2-01      tggga-----------------------tgccagagccgcgggcgccgcg
A0A076FZV9_BCL2-01      tggga-----------------------tgccggagccgcgggcgccgcg
A0A452EV13_BCL2-01      tggga-----------------------tgccggagccgcgggcgccgcg
A0A8C2N853_MCL1-01      tagggggaggggaagccggcacggtgattggcggaagcgccggc-ccgag
A0A8C2N853_MCL1-02      tagggggaggggaagccggcacggtgattggcggaagcgccggc-ccgag
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      tagggggaggggaagccggcacggtgattggcggaagcgccggc-ccgag
A0A452GA25_MCL1-02      ------------------------------------gcgccggc-ccgag
A0A8C2R4Z3_BCL2L2-      ------------------------------------ttgacagaccgact
A0A8C2R4Z3_BCL2L2-      agttttttatgtttgac-----------tccaacagccgcccggatggcg
A0A8C2R4Z3_BCL2L2-      agttttttatgtttgac-----------tccaacagccgcccggatggcg
A0A452ECF0_BCL2L2-      --------------------------------------------atggcg
A0A8C2R4Z3_BCL2L2-      --------------------------------------------atggcg
A0A452FHY1_BCL2L1-      tggag---------------------------------------------
A0A452FHY1_BCL2L1-      tggag---------------------------------------------
A0A452E1B1_BCL2L1-      tggagtcagtttagtga-----------tatggaagagaacagaactgag
A0A8C2NR03_BCL2L1-      tggagtcagtttagtga-----------tgtggaagagaacagaactgag
A0A452FWV3_BCL2L1-      tggagtcagtttagtga-----------tgtggaagagaacagaactgag
A0A8C2NR03_BCL2L1-      tggagtcagtttagtga-----------tgtggaagagaacagaactgag
                                                                          

A0A452EK63_BCL2A1-      tctgaaatatgtgttgcagatacagcaacctgg-----------------
A0A8C2RKE2_BCL2A1-      tctgaaatatgtgttgcagatacagcaacctgg-----------------
A0A8C2PEQ8_BCL2L10      cccccggtagag---gcggagcc----atggtg-----------------
A0A8C2PEQ8_BCL2L10      cccccggtagag---gcggagcc----atggtg-----------------
A0A8C2PEQ8_BCL2L10      cccccggtagag---gcggagcc----atggtg-----------------
A0A076FU27_BCL2-01      ccccccggggccgcccccgcgccgggcatcctg--------------tcc
A0A076FZV9_BCL2-01      ccccccggggccgctcccgcgccgggcatcctg--------------tcc
A0A452EV13_BCL2-01      ccccccggggccgcccccgcgccgggcatcctg--------------tcc
A0A8C2N853_MCL1-01      cccccc--ggccactcttgcgcccgacgcccggagggtcgcgcggccctc
A0A8C2N853_MCL1-02      cccccc--ggccactcttgcgcccgacgcccggagggtcgcgcggccctc
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      cccccc--ggccactcttgcgcccgacgcccggagggtcgcgcggccctc
A0A452GA25_MCL1-02      cccccc--ggccactcttgcgcccgacgcccggagggtcgcgcggccctc
A0A8C2R4Z3_BCL2L2-      tcccctaccgggatttgagaatttggcgc---a-----------------
A0A8C2R4Z3_BCL2L2-      accccagcc------tcagccccagacac---a-----------------
A0A8C2R4Z3_BCL2L2-      accccagcc------tcagccccagacac---a-----------------
A0A452ECF0_BCL2L2-      accccagcc------tcagccccagacac---a-----------------
A0A8C2R4Z3_BCL2L2-      accccagcc------tcagccccagacac---a-----------------
A0A452FHY1_BCL2L1-      -cctcagaaggg---acaaaatcagatatggaa-----------------
A0A452FHY1_BCL2L1-      -cctcagaaggg---acaaaatcagatatggaa-----------------
A0A452E1B1_BCL2L1-      accctagaaggg---acagaatcagatatggaa-----------------
A0A8C2NR03_BCL2L1-      gccccagaaggg---acagaatcagatatggaa-----------------
A0A452FWV3_BCL2L1-      gccccagaaggg---acagaatcagatatggaa-----------------
A0A8C2NR03_BCL2L1-      gccccagaaggg---acagaatcagatatggaa-----------------
                                                                          

A0A452EK63_BCL2A1-      ----atccaagccaag----------------------------------
A0A8C2RKE2_BCL2A1-      ----atccaagccaag----------------------------------
A0A8C2PEQ8_BCL2L10      --------gacccg------------------------------------
A0A8C2PEQ8_BCL2L10      --------gacccg------------------------------------
A0A8C2PEQ8_BCL2L10      --------gacccg------------------------------------
A0A076FU27_BCL2-01      tcccagccgggccgcacacc------------------------------
A0A076FZV9_BCL2-01      tcccagccgggccgcacacc------------------------------
A0A452EV13_BCL2-01      tcccagccgggccgcgcgcc------------------------------
A0A8C2N853_MCL1-01      gcccattggcgccgagggccccgacgtcaccgcgacccccaccagactgc
A0A8C2N853_MCL1-02      gcccattggcgccgagggccccgacgtcaccgcgacccccaccagactgc
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      gcccattggcgccgagggccccgacgtcaccgcgacccccaccagactgc
A0A452GA25_MCL1-02      gcccattggcgccgagggccccgacgtcaccgcgacccccaccagactgc
A0A8C2R4Z3_BCL2L2-      --------attccccg---c------------------------------
A0A8C2R4Z3_BCL2L2-      ------------cggg---c------------------------------
A0A8C2R4Z3_BCL2L2-      ------------cggg---c------------------------------
A0A452ECF0_BCL2L2-      ------------cggg---c------------------------------
A0A8C2R4Z3_BCL2L2-      ------------cggg---c------------------------------
A0A452FHY1_BCL2L1-      --------a-ccccaatgcc------------------------------
A0A452FHY1_BCL2L1-      --------a-ccccaatgcc------------------------------
A0A452E1B1_BCL2L1-      --------acccccagcgcc------------------------------
A0A8C2NR03_BCL2L1-      --------acccccagtgcc------------------------------
A0A452FWV3_BCL2L1-      --------acccccagtgcc------------------------------
A0A8C2NR03_BCL2L1-      --------acccccagtgcc------------------------------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      -------cgcgccc------------------------------------
A0A076FZV9_BCL2-01      -------cgcgccc------------------------------------
A0A452EV13_BCL2-01      -------cgcgccc------------------------------------
A0A8C2N853_MCL1-01      tgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatcc
A0A8C2N853_MCL1-02      tgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatcc
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      tgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatcc
A0A452GA25_MCL1-02      tgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatcc
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      ccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcga
A0A8C2N853_MCL1-02      ccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcga
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      ccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcga
A0A452GA25_MCL1-02      ccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcga
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      gccagaccctctcgggaagcggcctgccgtccggcctttagctttgatgg
A0A8C2N853_MCL1-02      gccagaccctctcgggaagcggcctgccgtccggcctttagctttgatgg
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      gccagaccctctcgggaagcggcctgccgtccggcctttagctttgatgg
A0A452GA25_MCL1-02      gccagaccctctcgggaagcggcctgccgtccggcctttagctttgatgg
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      ------------------------------caaaacatccagggtgttac
A0A8C2RKE2_BCL2A1-      ------------------------------caaaacatccagggtgttac
A0A8C2PEQ8_BCL2L10      ----------------------tttagggagcgcacggcccggctgctga
A0A8C2PEQ8_BCL2L10      ----------------------tttagggagcgcacggcccggctgctga
A0A8C2PEQ8_BCL2L10      ----------------------tttagggagcgcacggcccggctgctga
A0A076FU27_BCL2-01      ----------------------tccaggacc-------------tccccg
A0A076FZV9_BCL2-01      ----------------------tccaggacc-------------tccccg
A0A452EV13_BCL2-01      ----------------------tccaggacc-------------tccccg
A0A8C2N853_MCL1-01      tcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
A0A8C2N853_MCL1-02      tcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      tcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
A0A452GA25_MCL1-02      tcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
A0A8C2R4Z3_BCL2L2-      ----------------------cttagggg--------gtggggtcttat
A0A8C2R4Z3_BCL2L2-      ----------------------tctagtggcagactttgtgggctataag
A0A8C2R4Z3_BCL2L2-      ----------------------tctagtggcagactttgtgggctataag
A0A452ECF0_BCL2L2-      ----------------------tctagtggcagactttgtgggctataag
A0A8C2R4Z3_BCL2L2-      ----------------------tctagtggcagactttgtgggctataag
A0A452FHY1_BCL2L1-      ----------------------gtcaatgccaacccatcttggcacctgg
A0A452FHY1_BCL2L1-      ----------------------gtcaatgccaacccatcttggcacctgg
A0A452E1B1_BCL2L1-      ----------------------atcagtggcaacccatcctggcacctgg
A0A8C2NR03_BCL2L1-      ----------------------atcaatggcaacccatcttggcacctgg
A0A452FWV3_BCL2L1-      ----------------------atcaatggcaacccatcttggcacctgg
A0A8C2NR03_BCL2L1-      ----------------------atcaatggcaacccatcttggcacctgg
                                                                          

A0A452EK63_BCL2A1-      aagacgt-------------------------------------------
A0A8C2RKE2_BCL2A1-      aagacgt-------------------------------------------
A0A8C2PEQ8_BCL2L10      tggactacctggagttctgc------------------------------
A0A8C2PEQ8_BCL2L10      tggactacctggagttctgc------------------------------
A0A8C2PEQ8_BCL2L10      tggactacctggagttctgc------------------------------
A0A076FU27_BCL2-01      ccgccgccccc---------------------------------------
A0A076FZV9_BCL2-01      ccgccgccccc---------------------------------------
A0A452EV13_BCL2-01      ccgccgccccc---------------------------------------
A0A8C2N853_MCL1-01      acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccct
A0A8C2N853_MCL1-02      acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccct
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccct
A0A452GA25_MCL1-02      acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccct
A0A8C2R4Z3_BCL2L2-      ttgattgccaagtaatatcccccaatgg----------------------
A0A8C2R4Z3_BCL2L2-      ctgaggcagaaggggtatgttt--gtgg----------------------
A0A8C2R4Z3_BCL2L2-      ctgaggcagaaggggtatgttt--gtgg----------------------
A0A452ECF0_BCL2L2-      ctgaggcagaaggggtatgttt--gtgg----------------------
A0A8C2R4Z3_BCL2L2-      ctgaggcagaaggggtatgttt--gtgg----------------------
A0A452FHY1_BCL2L1-      cgcatagccctgcggtga------atgg----------------------
A0A452FHY1_BCL2L1-      cgcatagccctgcggtga------atgg----------------------
A0A452E1B1_BCL2L1-      cagatagctctgtggtga------atgg----------------------
A0A8C2NR03_BCL2L1-      cggatagccctgcggtga------atgg----------------------
A0A452FWV3_BCL2L1-      cggatagccctgcggtga------atgg----------------------
A0A8C2NR03_BCL2L1-      cggatagccctgcggtga------atgg----------------------
                                                                          

A0A452EK63_BCL2A1-      ------------------------------ggcttcctct----------
A0A8C2RKE2_BCL2A1-      ------------------------------ggcttcctct----------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      ------------------------------ggccgccgcc----------
A0A076FZV9_BCL2-01      ------------------------------ggccgccgcc----------
A0A452EV13_BCL2-01      ------------------------------ggccgccgcc----------
A0A8C2N853_MCL1-01      ggagattatctctcagtacctcctggagcaggcaaccggc----------
A0A8C2N853_MCL1-02      ggagattatctctcagtacctcctggagcaggcaaccggc----------
A0A8C2N853_MCL1-03      ------------------------------ggcaaccggc----------
A0A452GA25_MCL1-01      ggagattatctctcagtacctcctggagcaggcaaccggc----------
A0A452GA25_MCL1-02      ggagattatctctcagtacctcctggagcaggcaaccggc----------
A0A8C2R4Z3_BCL2L2-      ------------------------------agccctagctcnnnnnnnnn
A0A8C2R4Z3_BCL2L2-      ------------------------------agct----------------
A0A8C2R4Z3_BCL2L2-      ------------------------------agct----------------
A0A452ECF0_BCL2L2-      ------------------------------agct----------------
A0A8C2R4Z3_BCL2L2-      ------------------------------agct----------------
A0A452FHY1_BCL2L1-      ------------------------------agccactggccaca-cagaa
A0A452FHY1_BCL2L1-      ------------------------------agccactggccaca-cagaa
A0A452E1B1_BCL2L1-      ------------------------------agccactggtcacagcagaa
A0A8C2NR03_BCL2L1-      ------------------------------agccaccggccacagcagaa
A0A452FWV3_BCL2L1-      ------------------------------agccaccggccacagcagaa
A0A8C2NR03_BCL2L1-      ------------------------------agccaccggccacagcagaa
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      --------------------------------------------------
A0A8C2N853_MCL1-02      --------------------------------------------------
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      gcttggac------------------------------------------
A0A8C2NR03_BCL2L1-      gcttggat------------------------------------------
A0A452FWV3_BCL2L1-      gcttggat------------------------------------------
A0A8C2NR03_BCL2L1-      gcttggat------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      --------------------------------------------------
A0A8C2N853_MCL1-02      --------------------------------------------------
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      --------------------------------------------------
A0A8C2N853_MCL1-02      --------------------------------------------------
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      ----------------------------------gtccaggacga-----
A0A8C2RKE2_BCL2A1-      ----------------------------------gtccaggacga-----
A0A8C2PEQ8_BCL2L10      ----------------------------------gcccggg---------
A0A8C2PEQ8_BCL2L10      ----------------------------------gcccggg---------
A0A8C2PEQ8_BCL2L10      ----------------------------------gcccggg---------
A0A076FU27_BCL2-01      ----------------------------------gccgggcctgcg----
A0A076FZV9_BCL2-01      ----------------------------------gccgggcctgcg----
A0A452EV13_BCL2-01      ----------------------------------gccgggcctgcg----
A0A8C2N853_MCL1-01      ----------------------------------gccaaggacgcgaagc
A0A8C2N853_MCL1-02      ----------------------------------gccaaggacgcgaagc
A0A8C2N853_MCL1-03      ----------------------------------gccaaggacgcgaagc
A0A452GA25_MCL1-01      ----------------------------------gccaaggacgcgaagc
A0A452GA25_MCL1-02      ----------------------------------gccaaggacgcgaagc
A0A8C2R4Z3_BCL2L2-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaggccggggaggg----
A0A8C2R4Z3_BCL2L2-      ----------------------------------ggccccggggag----
A0A8C2R4Z3_BCL2L2-      ----------------------------------ggccccggggag----
A0A452ECF0_BCL2L2-      ----------------------------------ggccccggggag----
A0A8C2R4Z3_BCL2L2-      ----------------------------------ggccccggggag----
A0A452FHY1_BCL2L1-      ---------------------------------------gaaagtg----
A0A452FHY1_BCL2L1-      ---------------------------------------gaaagtg----
A0A452E1B1_BCL2L1-      ----------------------------------gctgggaaaatg----
A0A8C2NR03_BCL2L1-      ----------------------------------gcccgggaagtg----
A0A452FWV3_BCL2L1-      ----------------------------------gcccgggaagtg----
A0A8C2NR03_BCL2L1-      ----------------------------------gcccgggaagtg----
                                                                          

A0A452EK63_BCL2A1-      -------------------------------agtggaaaggactttgaag
A0A8C2RKE2_BCL2A1-      -------------------------------agtggaaaggactttgaag
A0A8C2PEQ8_BCL2L10      ---------agccc-----------------ggcactccagctcctgcgc
A0A8C2PEQ8_BCL2L10      ---------agccc-----------------ggcactccagctcctgcgc
A0A8C2PEQ8_BCL2L10      ---------agccc-----------------ggcactccagctcctgcgc
A0A076FU27_BCL2-01      ccc------agcccggtgccacctgt-----ggtccacctgaccctgcgc
A0A076FZV9_BCL2-01      ccc------agcccggtgccacctgt-----ggtccacctgaccctgcgc
A0A452EV13_BCL2-01      ccc------agcccggtgccacctgt-----ggtccacctgaccctgcgc
A0A8C2N853_MCL1-01      ccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgc
A0A8C2N853_MCL1-02      ccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgc
A0A8C2N853_MCL1-03      ccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgc
A0A452GA25_MCL1-01      ccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgc
A0A452GA25_MCL1-02      ccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgc
A0A8C2R4Z3_BCL2L2-      ---------ggccccggggggcgctg-----g-------ggactacggga
A0A8C2R4Z3_BCL2L2-      ---------ggcccagcagctgaccc-----gctacaccaagccatgcgg
A0A8C2R4Z3_BCL2L2-      ---------ggcccagcagctgaccc-----gctacaccaagccatgcgg
A0A452ECF0_BCL2L2-      ---------ggcccagcagctgaccc-----gctacaccaagccatgcgg
A0A8C2R4Z3_BCL2L2-      ---------ggcccagcagctgaccc-----gctacaccaagccatgcgg
A0A452FHY1_BCL2L1-      ---------gt-cctgtggcaa---c-----agcacagcaagccccgagg
A0A452FHY1_BCL2L1-      ---------gt-cctgtggcaa---c-----agcacagcaagccccgagg
A0A452E1B1_BCL2L1-      ---------atccccacggcag---t-----ggtgaagcaagccctgagg
A0A8C2NR03_BCL2L1-      ---------atccccatggcag---c-----ggtgaagcaagccctgagg
A0A452FWV3_BCL2L1-      ---------atccccatggcag---c-----ggtgaagcaagccctgagg
A0A8C2NR03_BCL2L1-      ---------atccccatggcag---c-----ggtgaagcaagccctgagg
                                                                      *   

A0A452EK63_BCL2A1-      cagtgcttggataagtttga---tgtggtgtctgtagaca----------
A0A8C2RKE2_BCL2A1-      cagtgcttggataagtttga---tgtggtgtctgtagaca----------
A0A8C2PEQ8_BCL2L10      cgtccacgc-ctgaggctgc-tgtgctgcgccacgtggccgcccgtgtcc
A0A8C2PEQ8_BCL2L10      cgtccacgc-ctgaggctgc-tgtgctgcgccacgtggccgcccgtgtcc
A0A8C2PEQ8_BCL2L10      cgtccacgc-ctgaggctgc-tgtgctgcgccacgtggccgcccgtgtcc
A0A076FU27_BCL2-01      caggccggcgatgacttctc-tcggcgctaccgccgcgacttcgccgaga
A0A076FZV9_BCL2-01      caggccggcgatgacttctc-tcggcgctaccgccgcgacttcgccgaga
A0A452EV13_BCL2-01      caggccggcgatgacttctc-tcggcgctaccgccgcgacttcgccgaga
A0A8C2N853_MCL1-01      cgagtcggggatggggt----gcagcgcaacca------------cgaga
A0A8C2N853_MCL1-02      cgagtcggggatggggt----gcagcgcaacca------------cgaga
A0A8C2N853_MCL1-03      cgagtcggggatggggt----gcagcgcaacca------------cgaga
A0A452GA25_MCL1-01      cgagtcggggatggggt----gcagcgcaacca------------cgaga
A0A452GA25_MCL1-02      cgagtcggggatggggt----gcagcgcaacca------------cgaga
A0A8C2R4Z3_BCL2L2-      acggcttg----gagtctgaggaactggagcctgaggagctgct----gc
A0A8C2R4Z3_BCL2L2-      gcagctggagatgagtttga-gacccgcttccggcgcaccttctccgatc
A0A8C2R4Z3_BCL2L2-      gcagctggagatgagtttga-gacccgcttccggcgcaccttctccgatc
A0A452ECF0_BCL2L2-      gcagctggagatgagtttga-gacccgcttccggcgcaccttctccgatc
A0A8C2R4Z3_BCL2L2-      gcagctggagatgagtttga-gacccgcttccggcgcaccttctccgatc
A0A452FHY1_BCL2L1-      gaggcaggcagcgagtttga-actgaggcaccaacagacggtcagcgacc
A0A452FHY1_BCL2L1-      gaggcaggcagcgagtttga-actgaggcaccaacagacggtcagcgacc
A0A452E1B1_BCL2L1-      gaggcaagcaatgagtgtga-attgaggtaccaacagacattcagcgacc
A0A8C2NR03_BCL2L1-      gaggcaggcgatgagtttga-actgaggtaccgacgggcattcagcgacc
A0A452FWV3_BCL2L1-      gaggcaggcgatgagtttga-actgaggtaccgacgggcattcagcgacc
A0A8C2NR03_BCL2L1-      gaggcaggcgatgagtttga-actgaggtaccgacgggcattcagcgacc
                                                       *                  

A0A452EK63_BCL2A1-      -------------------ctgc-----------------------caga
A0A8C2RKE2_BCL2A1-      -------------------ctgc-----------------------caga
A0A8C2PEQ8_BCL2L10      tggaagcaaatcgaaacgtcttgcccctatacc----gccgctaccgcag
A0A8C2PEQ8_BCL2L10      tggaagcaaatcgaaacgtcttgcccctatacc----gccgctaccgcag
A0A8C2PEQ8_BCL2L10      tggaagcaaatcgaaacgtcttgcccctatacc----gccgctaccgcag
A0A076FU27_BCL2-01      tgt-----ccagccag---ctgcacctgacgcccttcaccgcga--gggg
A0A076FZV9_BCL2-01      tgt-----ccagccag---ctgcacctgacgcccttcaccgcga--gggg
A0A452EV13_BCL2-01      tgt-----ccagccag---ctgcacctgacgcccttcaccgcga--gggg
A0A8C2N853_MCL1-01      cgg-----ctttccaaggcatgcttcggaaactggacatcaaaaacgaag
A0A8C2N853_MCL1-02      cgg-----ctttccaaggcatgcttcggaaactggacatcaaaaacgaag
A0A8C2N853_MCL1-03      cgg-----ctttccaaggcatgcttcggaaactggacatcaaaaacgaag
A0A452GA25_MCL1-01      cgg-----ctttccaaggcatgcttcggaaactggacatcaaaaacgaag
A0A452GA25_MCL1-02      cgg-----ctttccaaggcatgcttcggaaactggacatcaaaaacgaag
A0A8C2R4Z3_BCL2L2-      tgg-----agcccgag---ccg-----gagccc-------------gagc
A0A8C2R4Z3_BCL2L2-      tgg-----cagctcag---ctgcatgtgacccc-------------gggt
A0A8C2R4Z3_BCL2L2-      tgg-----cagctcag---ctgcatgtgacccc-------------gggt
A0A452ECF0_BCL2L2-      tgg-----cagctcag---ctgcatgtgacccc-------------gggt
A0A8C2R4Z3_BCL2L2-      tgg-----cagctcag---ctgcatgtgacccc-------------gggt
A0A452FHY1_BCL2L1-      tga-----cgtcccag---ctccacaccacccc-------------aggg
A0A452FHY1_BCL2L1-      tga-----cgtcccag---ctccacaccacccc-------------aggg
A0A452E1B1_BCL2L1-      tga-----cgtcccag---ctccacatcacccc-------------aggg
A0A8C2NR03_BCL2L1-      tga-----cgtcccag---ctccacattacccc-------------aggg
A0A452FWV3_BCL2L1-      tga-----cgtcccag---ctccacattacccc-------------aggg
A0A8C2NR03_BCL2L1-      tga-----cgtcccag---ctccacattacccc-------------aggg
                                                                          

A0A452EK63_BCL2A1-      acaata---------ttcaaccaa-gtgatggaaaaggaatttgaaga--
A0A8C2RKE2_BCL2A1-      acaata---------ttcaaccaa-gtgatggaaaaggaatttgaaga--
A0A8C2PEQ8_BCL2L10      gcaccgcgtcgagctggtggccaggatggcgcagaggctgctcgacgaag
A0A8C2PEQ8_BCL2L10      gcaccgcgtcgagctggtggccaggatggcgcagaggctgctcgacgaag
A0A8C2PEQ8_BCL2L10      gcaccgcgtcgagctggtggccaggatggcgcagaggctgctcgacgaag
A0A076FU27_BCL2-01      acg-----------cttcgccacg-gtggtggaggagctcttcaggga--
A0A076FZV9_BCL2-01      acg-----------cttcgccacg-gtggtggaggagctcttcaggga--
A0A452EV13_BCL2-01      acg-----------cttcgccacg-gtggtggaggagctcttcaggga--
A0A8C2N853_MCL1-01      acga--tgtcaagtctttgtctcgagtgatggttcatgttttcagtga--
A0A8C2N853_MCL1-02      acga--tgtcaagtctttgtctcgagtgatggttcatgttttcagtga--
A0A8C2N853_MCL1-03      acga--tgtcaagtctttgtctcgagtgatggttcatgttttcagtga--
A0A452GA25_MCL1-01      acga--tgtcaagtctttgtctcgagtgatggttcatgttttcagtga--
A0A452GA25_MCL1-02      acga--tgtcaagtctttgtctcgagtgatggttcatgttttcagtga--
A0A8C2R4Z3_BCL2L2-      ccga---agaggagc--cgccccg-gcccc------gcgcccccccgg--
A0A8C2R4Z3_BCL2L2-      tcggcccagcagcgcttcacccag-gtctctgatgaactcttccaagg--
A0A8C2R4Z3_BCL2L2-      tcggcccagcagcgcttcacccag-gtctctgatgaactcttccaagg--
A0A452ECF0_BCL2L2-      tcggcccagcagcgcttcacccag-gtctctgatgaactcttccaagg--
A0A8C2R4Z3_BCL2L2-      tcggcccagcagcgcttcacccag-gtctctgatgaactcttccaagg--
A0A452FHY1_BCL2L1-      acagcatatcagagctttgaacag-gtaatgtatgagctcttctggga--
A0A452FHY1_BCL2L1-      acagcatatcagagctttgaacag-gtaatgtatgagctcttctggga--
A0A452E1B1_BCL2L1-      acaacatatcagagctttgaacag-gtaataaatgaactcttccagga--
A0A8C2NR03_BCL2L1-      acagcatatcagagctttgaacag-gtagtgaatgaactcttccggga--
A0A452FWV3_BCL2L1-      acagcatatcagagctttgaacag-gtagtgaatgaactcttccggga--
A0A8C2NR03_BCL2L1-      acagcatatcagagctttgaacag-gtagtgaatgaactcttccggga--
                         *                                            *   

A0A452EK63_BCL2A1-      ----tggcattgttaactggggcaggattgtaaccatattcgcctttga-
A0A8C2RKE2_BCL2A1-      ----tggcattgttaactggggcaggattgtaaccatattcgcctttga-
A0A8C2PEQ8_BCL2L10      accctggccc---cagctggggccgcgtggcctcactcgtgaccttcgc-
A0A8C2PEQ8_BCL2L10      accctggccc---cagctggggccgcgtggcctcactcgtgaccttcgc-
A0A8C2PEQ8_BCL2L10      accctggccc---cagctggggccgcgtggcctcactcgtgaccttcgc-
A0A076FU27_BCL2-01      ----cggggt---gaactgggggcgcatcgtggccttctttgagttcgg-
A0A076FZV9_BCL2-01      ----cggggt---gaactgggggcgcatcgtggccttctttgagttcgg-
A0A452EV13_BCL2-01      ----cggggt---gaactgggggcgcatcgtggccttctttgagttcgg-
A0A8C2N853_MCL1-01      ----cggagtaacaaactggggcaggattgtgactcttatttcttttggt
A0A8C2N853_MCL1-02      ----cggagtaacaaactggggcaggattgtgactcttatttcttttggt
A0A8C2N853_MCL1-03      ----cggagtaacaaactggggcaggattgtgactcttatttcttttggt
A0A452GA25_MCL1-01      ----cggagtaacaaactggggcaggattgtgactcttatttcttttggt
A0A452GA25_MCL1-02      ----cggagtaacaaactggggcaggattgtgactcttatttcttttggt
A0A8C2R4Z3_BCL2L2-      ----gagctc---cgg--------gccctg-ggcc-----tggctcggg-
A0A8C2R4Z3_BCL2L2-      ----gggccc---caactggggtcgccttgtggccttctttgtctttgg-
A0A8C2R4Z3_BCL2L2-      ----gggccc---caactggggtcgccttgtggccttctttgtctttgg-
A0A452ECF0_BCL2L2-      ----gggccc---caactggggtcgccttgtggccttctttgtctttgg-
A0A8C2R4Z3_BCL2L2-      ----gggccc---caactggggtcgccttgtggccttctttgtctttgg-
A0A452FHY1_BCL2L1-      ----cggggt---gaactgggatcacactgtggcctttttctccttcag-
A0A452FHY1_BCL2L1-      ----cggggt---gaactgggatcacactgtggcctttttctccttcag-
A0A452E1B1_BCL2L1-      ----tggggt---gaactggtgtcgcaatgtggcctttttctccttcgg-
A0A8C2NR03_BCL2L1-      ----cggggt---gaactggggtcgcattgtggcctttttctccttcgg-
A0A452FWV3_BCL2L1-      ----cggggt---gaactggggtcgcattgtggcctttttctccttcgg-
A0A8C2NR03_BCL2L1-      ----cggggt---gaactggggtcgcattgtggcctttttctccttcgg-
                              *                      *   *          *     

A0A452EK63_BCL2A1-      -----aggtattct-taccaagaaacttctgagcaagcgtattgcctcag
A0A8C2RKE2_BCL2A1-      -----aggtattct-taccaagaaacttctgagcaagcgtattgcctcag
A0A8C2PEQ8_BCL2L10      -----ggggtctctgc---tggagaggcagccgcagacgacccgacggca
A0A8C2PEQ8_BCL2L10      -----ggggtctctgc---tggagaggcagccgcagacgacccgacggca
A0A8C2PEQ8_BCL2L10      -----ggggtctctgc---tggagaggcagccgcagacgacccgacggca
A0A076FU27_BCL2-01      -----aggggtcatatgtgtggagag-------------------cgtca
A0A076FZV9_BCL2-01      -----aggggtcatgtgtgtggagag-------------------cgtca
A0A452EV13_BCL2-01      -----aggggtcatgtgtgtggagag-------------------cgtca
A0A8C2N853_MCL1-01      gcctttgtggccaaacacttgaagag-------------------tataa
A0A8C2N853_MCL1-02      gcctttgtggccaaacacttgaagag-------------------tataa
A0A8C2N853_MCL1-03      gcctttgtggccaaacacttgaagag-------------------tataa
A0A452GA25_MCL1-01      gcctttgtggccaaacacttgaagag-------------------tataa
A0A452GA25_MCL1-02      gcctttgtggccaaacacttgaagag-------------------tataa
A0A8C2R4Z3_BCL2L2-      -----agcccc----------------------------------cggca
A0A8C2R4Z3_BCL2L2-      -----agccgcactgtgtgctgagag-------------------tgtca
A0A8C2R4Z3_BCL2L2-      -----agccgcactgtgtgctgagag-------------------tgtca
A0A452ECF0_BCL2L2-      -----agccgcactgtgtgctgagag-------------------tgtca
A0A8C2R4Z3_BCL2L2-      -----agccgcactgtgtgctgagag-------------------tgtca
A0A452FHY1_BCL2L1-      -----gggggcactatgcatggaaag-------------------cgtag
A0A452FHY1_BCL2L1-      -----gggggcactatgcatggaaag-------------------cgtag
A0A452E1B1_BCL2L1-      -----tggggcactatgcatgaaaag-------------------catag
A0A8C2NR03_BCL2L1-      -----tggggcactgtgcgtggaaag-------------------cgtag
A0A452FWV3_BCL2L1-      -----tggggcactgtgcgtggaaag-------------------cgtag
A0A8C2NR03_BCL2L1-      -----tggggcactgtgcgtggaaag-------------------cgtag
                              *                                           

A0A452EK63_BCL2A1-      acatggaca--------------tgtgcaaggacatttcttatttcg-tg
A0A8C2RKE2_BCL2A1-      acatggaca--------------tgtgcaaggacatttcttatttcg-tg
A0A8C2PEQ8_BCL2L10      gaagagaga---cgacggcagcgttagcagggactgtcggctcctcgtgg
A0A8C2PEQ8_BCL2L10      gaagagaga---cgacggcagcgttagcagggactgtcggctcctcgtgg
A0A8C2PEQ8_BCL2L10      gaagagaga---cgacggcagcgttagcagggactgtcggctcctcgtgg
A0A076FU27_BCL2-01      accgggaga----tgtcg--cccctggtggacagcatcgccctgtggatg
A0A076FZV9_BCL2-01      accgggaga----tgtcg--cccctggtggacagcatcgccctgtggatg
A0A452EV13_BCL2-01      accgggaga----tgtcg--cccctggtggacagcatcgccctgtggatg
A0A8C2N853_MCL1-01      atcaagaaagctgcatcgaaccactagcagaaagcatcac-----agatg
A0A8C2N853_MCL1-02      atcaagaaagctgcatcgaaccactagcagaaagcatcac-----agatg
A0A8C2N853_MCL1-03      atcaagaaagctgcatcgaaccactagcagaaagcatcac-----agatg
A0A452GA25_MCL1-01      atcaagaaagctgcatcgaaccactagcagaaagcatcac-----agatg
A0A452GA25_MCL1-02      atcaagaaagctgcatcgaaccactagcagaaagcatcac-----agatg
A0A8C2R4Z3_BCL2L2-      accaggagg------aggag------gaggagc-----cgggactggtcg
A0A8C2R4Z3_BCL2L2-      acaaggaga------tggagccacttgtgggacaagtgcaggagtggatg
A0A8C2R4Z3_BCL2L2-      acaaggaga------tggagccacttgtgggacaagtgcaggagtggatg
A0A452ECF0_BCL2L2-      acaaggaga------tggagccacttgtgggacaagtgcaggagtggatg
A0A8C2R4Z3_BCL2L2-      acaaggaga------tggagccacttgtgggacaagtgcaggagtggatg
A0A452FHY1_BCL2L1-      acaaggaga------tgcaggtattggtgagtcaggtcatgacttggatg
A0A452FHY1_BCL2L1-      acaaggaga------tgcaggtattggtgagtcaggtcatgacttggatg
A0A452E1B1_BCL2L1-      tcaaggaga------tgcaggtattggtaagtcaggtcacgacttggatg
A0A8C2NR03_BCL2L1-      acaaggaga------tgcaggtattggtgagtcggatcgcaacttggatg
A0A452FWV3_BCL2L1-      acaaggaga------tgcaggtattggtgagtcggatcgcaacttggatg
A0A8C2NR03_BCL2L1-      acaaggaga------tgcaggtattggtgagtcggatcgcaacttggatg
                             **                   *                   *  *

A0A452EK63_BCL2A1-      gc--------ggagtttatcaccgaaaacacaggagagtggataaggcaa
A0A8C2RKE2_BCL2A1-      gc--------ggagtttatcaccgaaaacacaggagagtggataaggcaa
A0A8C2PEQ8_BCL2L10      cccttctctgcgctcagttctgcgaaaagcaccgcgcctggctgatggcg
A0A8C2PEQ8_BCL2L10      cccttctctgcgctcagttctgcgaaaagcaccgcgcctggctgatggcg
A0A8C2PEQ8_BCL2L10      cccttctctgcgctcagttctgcgaaaagcaccgcgcctggctgatggcg
A0A076FU27_BCL2-01      ac--------cgagtacctgaaccggcacctgcacgcctggatccaggac
A0A076FZV9_BCL2-01      ac--------cgagtacctgaaccggcacctgcacgcctggatccaggac
A0A452EV13_BCL2-01      ac--------cgagtacctgaaccggcacctgcacgcctggatccaggac
A0A8C2N853_MCL1-01      tt--------ctcgta-------aggtcaaaacgagactggatagtcaaa
A0A8C2N853_MCL1-02      tt--------ctcgta-------aggtcaaaacgagactggatagtcaaa
A0A8C2N853_MCL1-03      tt--------ctcgta-------aggtcaaaacgagactggatagtcaaa
A0A452GA25_MCL1-01      tt--------ctcgta-------aggtcaaaacgagactggatagtcaaa
A0A452GA25_MCL1-02      tt--------ctcgta-------aggtcaaaacgagactggatagtcaaa
A0A8C2R4Z3_BCL2L2-      ag--------ggtgacccgggggacggcgc-------------------c
A0A8C2R4Z3_BCL2L2-      gt--------ggcctacctggagacgcggctggctgactggatccacagc
A0A8C2R4Z3_BCL2L2-      gt--------ggcctacctggagacgcggctggctgactggatccacagc
A0A452ECF0_BCL2L2-      gt--------ggcctacctggagacgcggctggctgactggatccacagc
A0A8C2R4Z3_BCL2L2-      gt--------ggcctacctggagacgcggctggctgactggatccacagc
A0A452FHY1_BCL2L1-      gc--------cagccagctaaatgaccacctagagccttggatccaggag
A0A452FHY1_BCL2L1-      gc--------cagccagctaaatgaccacctagagccttggatccaggag
A0A452E1B1_BCL2L1-      gc--------cacttacctaaataaccacctagagccttggatccaggag
A0A8C2NR03_BCL2L1-      gc--------tacttacctgaatgaccacctagagccttggatccaggag
A0A452FWV3_BCL2L1-      gc--------tacttacctgaatgaccacctagagccttggatccaggag
A0A8C2NR03_BCL2L1-      gc--------tacttacctgaatgaccacctagagccttggatccaggag
                                                                          

A0A452EK63_BCL2A1-      aacggaggctg---------------------------------------
A0A8C2RKE2_BCL2A1-      aacggaggctg---------------------------------------
A0A8C2PEQ8_BCL2L10      aacggcggctg---------------------------------------
A0A8C2PEQ8_BCL2L10      aacggcggctg---------------------------------------
A0A8C2PEQ8_BCL2L10      aacggcggctg---------------------------------------
A0A076FU27_BCL2-01      aacggaggctg---------------------------------------
A0A076FZV9_BCL2-01      aacggaggctg---------------------------------------
A0A452EV13_BCL2-01      aacggaggctg---------------------------------------
A0A8C2N853_MCL1-01      caaagaggctg---------------------------------------
A0A8C2N853_MCL1-02      caaagaggctg---------------------------------------
A0A8C2N853_MCL1-03      caaagaggctg---------------------------------------
A0A452GA25_MCL1-01      caaagaggctg---------------------------------------
A0A452GA25_MCL1-02      caaagaggctg---------------------------------------
A0A8C2R4Z3_BCL2L2-      attgaggaccc---------------------------------------
A0A8C2R4Z3_BCL2L2-      agtgggggctg---------------------------------------
A0A8C2R4Z3_BCL2L2-      agtgggggctg---------------------------------------
A0A452ECF0_BCL2L2-      agtgggggctgggcggagttcacagctctatacggggacggggccctgga
A0A8C2R4Z3_BCL2L2-      agtgggggctgggcggagttcacagctctatacggggacggggccctgga
A0A452FHY1_BCL2L1-      aatggcggctg---------------------------------------
A0A452FHY1_BCL2L1-      aatggcggctg---------------------------------------
A0A452E1B1_BCL2L1-      aatggcgactg---------------------------------------
A0A8C2NR03_BCL2L1-      aacggcggctg---------------------------------------
A0A452FWV3_BCL2L1-      aacggcggctg---------------------------------------
A0A8C2NR03_BCL2L1-      aacggcggctg---------------------------------------
                              * *                                         

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      --------------------------------------------------
A0A8C2N853_MCL1-02      --------------------------------------------------
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      ggaggcgcggcgtctgcgggaggggaactgggcctcagtgaggacagtgc
A0A8C2R4Z3_BCL2L2-      ggaggcgcggcgtctgcgggaggggaactgggcctcagtgaggacagtgc
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      ----------------------------gga-------------------
A0A8C2RKE2_BCL2A1-      ----------------------------gga-------------------
A0A8C2PEQ8_BCL2L10      ----------------------------gga-------------------
A0A8C2PEQ8_BCL2L10      ----------------------------gga-------------------
A0A8C2PEQ8_BCL2L10      ----------------------------gga-------------------
A0A076FU27_BCL2-01      ----------------------------gga-------------------
A0A076FZV9_BCL2-01      ----------------------------gga-------------------
A0A452EV13_BCL2-01      ----------------------------gga-------------------
A0A8C2N853_MCL1-01      ----------------------------gga-------------------
A0A8C2N853_MCL1-02      ----------------------------gga-------------------
A0A8C2N853_MCL1-03      ----------------------------gga-------------------
A0A452GA25_MCL1-01      ----------------------------gga-------------------
A0A452GA25_MCL1-02      ----------------------------gga-------------------
A0A8C2R4Z3_BCL2L2-      ----------------------------ggagctggaagcgatcaaagct
A0A8C2R4Z3_BCL2L2-      ----------------------------ggagctggaagcgatcaaagct
A0A8C2R4Z3_BCL2L2-      ----------------------------ggagctggaagcgatcaaagct
A0A452ECF0_BCL2L2-      tgacgggggctgtggcactgggggccctgg--------------------
A0A8C2R4Z3_BCL2L2-      tgacgggggctgtggcactgggggccctggagctggaagcgatcaaagct
A0A452FHY1_BCL2L1-      ----------------------------gga-------------------
A0A452FHY1_BCL2L1-      ----------------------------gga-------------------
A0A452E1B1_BCL2L1-      ----------------------------gga-------------------
A0A8C2NR03_BCL2L1-      ----------------------------ggt-------------------
A0A452FWV3_BCL2L1-      ----------------------------gga-------------------
A0A8C2NR03_BCL2L1-      ----------------------------gga-------------------
                                                    **                    

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      --------------------------------------------------
A0A8C2N853_MCL1-02      --------------------------------------------------
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      cgagttagggagatggaggaagaagctgagaagctaaaggagctacagaa
A0A8C2R4Z3_BCL2L2-      cgagttagggagatggaggaagaagctgagaagctaaaggagctacagaa
A0A8C2R4Z3_BCL2L2-      cgagttagggagatggaggaagaagctgagaagctaaaggagctacagaa
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      cgagttagggagatggaggaagaagctgagaagctaaaggagctacagaa
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      --------------------------aaatgggtttgtaaag--------
A0A8C2RKE2_BCL2A1-      --------------------------aaatgggtttgtaaag--------
A0A8C2PEQ8_BCL2L10      -----------------tggattttgtctctccttcagccactcattgca
A0A8C2PEQ8_BCL2L10      -----------------tggattttgtctctccttcagccactcattgca
A0A8C2PEQ8_BCL2L10      -----------------tggattttgtctctccttcagccactcattgca
A0A076FU27_BCL2-01      -----------------------------cgcctttgtggagctgt----
A0A076FZV9_BCL2-01      -----------------------------cgcctttgtggagctgt----
A0A452EV13_BCL2-01      -----------------------------cgcctttgtggagctgt----
A0A8C2N853_MCL1-01      -----------------------------tgggtttgtggagttct----
A0A8C2N853_MCL1-02      -----------------------------tgggtttgtggagttct----
A0A8C2N853_MCL1-03      -----------------------------tgggtttgtggagttct----
A0A452GA25_MCL1-01      -----------------------------tgggtttgtggagttct----
A0A452GA25_MCL1-02      -----------------------------tgggtttgtggagttct----
A0A8C2R4Z3_BCL2L2-      cgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcc
A0A8C2R4Z3_BCL2L2-      cgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcc
A0A8C2R4Z3_BCL2L2-      cgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcc
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      cgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcc
A0A452FHY1_BCL2L1-      -----------------------------cacttctgtggaat-------
A0A452FHY1_BCL2L1-      -----------------------------cacttctgtggaat-------
A0A452E1B1_BCL2L1-      -----------------------------catttttgtggaac-------
A0A8C2NR03_BCL2L1-      -----------------------------aagaattgtgtgca-------
A0A452FWV3_BCL2L1-      -----------------------------cacgtttgtggaac-------
A0A8C2NR03_BCL2L1-      -----------------------------cacgtttgtggaac-------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      ------------------------------------------------ac
A0A8C2PEQ8_BCL2L10      ------------------------------------------------ac
A0A8C2PEQ8_BCL2L10      ------------------------------------------------ac
A0A076FU27_BCL2-01      ------------------------------------------------ac
A0A076FZV9_BCL2-01      ------------------------------------------------ac
A0A452EV13_BCL2-01      ------------------------------------------------ac
A0A8C2N853_MCL1-01      ------------------------------------------------tc
A0A8C2N853_MCL1-02      ------------------------------------------------tc
A0A8C2N853_MCL1-03      ------------------------------------------------tc
A0A452GA25_MCL1-01      ------------------------------------------------tc
A0A452GA25_MCL1-02      ------------------------------------------------tc
A0A8C2R4Z3_BCL2L2-      cagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatc
A0A8C2R4Z3_BCL2L2-      cagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatc
A0A8C2R4Z3_BCL2L2-      cagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatc
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      cagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatc
A0A452FHY1_BCL2L1-      ------------------------------------------------tc
A0A452FHY1_BCL2L1-      ------------------------------------------------tc
A0A452E1B1_BCL2L1-      ------------------------------------------------tc
A0A8C2NR03_BCL2L1-      ------------------------------------------------ta
A0A452FWV3_BCL2L1-      ------------------------------------------------tc
A0A8C2NR03_BCL2L1-      ------------------------------------------------tc
                                                                          

A0A452EK63_BCL2A1-      -------------------------------aagtttgaaaccaaa----
A0A8C2RKE2_BCL2A1-      -------------------------------aagtttgaaaccaaa----
A0A8C2PEQ8_BCL2L10      catcttgggaa--------------------agacatctggtctgg----
A0A8C2PEQ8_BCL2L10      catcttgggaa--------------------agacatctggtctgg----
A0A8C2PEQ8_BCL2L10      catcttgggaa--------------------agacatctggtctgg----
A0A076FU27_BCL2-01      --------ggccc------------------tagcatgcggcccct----
A0A076FZV9_BCL2-01      --------ggccc------------------tagcatgcggcccct----
A0A452EV13_BCL2-01      --------ggccc------------------tagcatgcggcccct----
A0A8C2N853_MCL1-01      catgtagaggacc------------------tagaaggcggc--------
A0A8C2N853_MCL1-02      catgtagaggacc------------------tagaaggcggc--------
A0A8C2N853_MCL1-03      catgtagaggacc------------------tagaaggcggc--------
A0A452GA25_MCL1-01      catgtagaggacc------------------tagaaggcggc--------
A0A452GA25_MCL1-02      catgtagaggacc------------------tagaaggcggc--------
A0A8C2R4Z3_BCL2L2-      tatgttggcaatg------------------tggactatggtgcaacagc
A0A8C2R4Z3_BCL2L2-      tatgttggcaatg------------------tggactatggtgcaacagc
A0A8C2R4Z3_BCL2L2-      tatgttggcaatg------------------tggactatggtgcaacagc
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      tatgttggcaatg------------------tggactatggtgcaacagc
A0A452FHY1_BCL2L1-      tgtgaaaacaata--------cag-------caaccgagagccaaa----
A0A452FHY1_BCL2L1-      tgtgaaaacaata--------cag-------caaccgagagccaaa----
A0A452E1B1_BCL2L1-      tacgaaaacaata--------cag-------caaccgagagccaaa----
A0A8C2NR03_BCL2L1-      aagggagaagatggcctgctccaggtgtgtctacttgattgtgggggatg
A0A452FWV3_BCL2L1-      tatgggaacaacg--------cag-------cagccgagagccgga----
A0A8C2NR03_BCL2L1-      tatgggaacaacg--------cag-------cagccgagagccgga----
                                                                          

A0A452EK63_BCL2A1-      -------------------------------------tctggctggctga
A0A8C2RKE2_BCL2A1-      -------------------------------------tctggctggctga
A0A8C2PEQ8_BCL2L10      -------------------------------------tttttcctc----
A0A8C2PEQ8_BCL2L10      -------------------------------------tttttcctc----
A0A8C2PEQ8_BCL2L10      -------------------------------------tttttcctc----
A0A076FU27_BCL2-01      ------gtttgat------------------------ttctcctgg----
A0A076FZV9_BCL2-01      ------gtttgat------------------------ttctcctgg----
A0A452EV13_BCL2-01      ------gtttgat------------------------ttctcctgg----
A0A8C2N853_MCL1-01      ------atcagaa------------------------atgtgctgc----
A0A8C2N853_MCL1-02      ------atcagaa------------------------atgtgctgc----
A0A8C2N853_MCL1-03      ------atcagaa------------------------atgtgctgc----
A0A452GA25_MCL1-01      ------atcagaa------------------------atgtgctgc----
A0A452GA25_MCL1-02      ------atcagaa------------------------atgtgctgc----
A0A8C2R4Z3_BCL2L2-      agaagagctagaagcacacttccacggctgtggttcagtcaaccgcgtta
A0A8C2R4Z3_BCL2L2-      agaagagctagaagcacacttccacggctgtggttcagtcaaccgcgtta
A0A8C2R4Z3_BCL2L2-      agaagagctagaagcacacttccacggctgtggttcagtcaaccgcgtta
A0A452ECF0_BCL2L2-      ---------------------------------------taaccg-----
A0A8C2R4Z3_BCL2L2-      agaagagctagaagcacacttccacggctgtggttcagtcaaccgcgtta
A0A452FHY1_BCL2L1-      ---agggccaggagcgc--------------------ttcaactgc----
A0A452FHY1_BCL2L1-      ---agggccaggagcgc--------------------ttcaactgc----
A0A452E1B1_BCL2L1-      ---agggccaagagcac--------------------ttcaaccgc----
A0A8C2NR03_BCL2L1-      cccaaggactggcgttc--------------------ctcatctat----
A0A452FWV3_BCL2L1-      ---agggccaggagcgc--------------------ttcaaccgc----
A0A8C2NR03_BCL2L1-      ---agggccaggagc-c--------------------cacagccac----
                                                                  *       

A0A452EK63_BCL2A1-      ct------------------------------------------------
A0A8C2RKE2_BCL2A1-      ct------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      --------------------------------------------------
A0A8C2N853_MCL1-02      --------------------------------------------------
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      ctatactctgtgacaaatttagtggccatcccaaagggtttgcatatata
A0A8C2R4Z3_BCL2L2-      ctatactctgtgacaaatttagtggccatcccaaagggtttgcatatata
A0A8C2R4Z3_BCL2L2-      ctatactctgtgacaaatttagtggccatcccaaagggtttgcatatata
A0A452ECF0_BCL2L2-      -------------------taggggcctt---------------------
A0A8C2R4Z3_BCL2L2-      ctatactctgtgacaaatttagtggccatcccaaagggtttgcatatata
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      --------------------------------------------------
A0A8C2N853_MCL1-02      --------------------------------------------------
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccctggccttagatgaatc
A0A8C2R4Z3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccctggccttagatgaatc
A0A8C2R4Z3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccctggccttagatgaatc
A0A452ECF0_BCL2L2-      ----------------------------tttcgctagc------------
A0A8C2R4Z3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccctggccttagatgaatc
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      -----------------------------tttctgg--------------
A0A8C2RKE2_BCL2A1-      -----------------------------tttctgg--------------
A0A8C2PEQ8_BCL2L10      --------------------------tcatactgga--------------
A0A8C2PEQ8_BCL2L10      --------------------------tcatactgga--------------
A0A8C2PEQ8_BCL2L10      --------------------------tcatactgga--------------
A0A076FU27_BCL2-01      --------------------------ctgtctctg---------------
A0A076FZV9_BCL2-01      --------------------------ctgtctctg---------------
A0A452EV13_BCL2-01      --------------------------ctgtctctg---------------
A0A8C2N853_MCL1-01      --------------------------tggcttttg---------------
A0A8C2N853_MCL1-02      --------------------------tggcttttg---------------
A0A8C2N853_MCL1-03      --------------------------tggcttttg---------------
A0A452GA25_MCL1-01      --------------------------tggcttttg---------------
A0A452GA25_MCL1-02      --------------------------tggcttttg---------------
A0A8C2R4Z3_BCL2L2-      cttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagac
A0A8C2R4Z3_BCL2L2-      cttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagac
A0A8C2R4Z3_BCL2L2-      cttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagac
A0A452ECF0_BCL2L2-      -----------------------aagtga---------------------
A0A8C2R4Z3_BCL2L2-      cttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagac
A0A452FHY1_BCL2L1-      --------------------------tggtccctga--------------
A0A452FHY1_BCL2L1-      --------------------------tggtccctga--------------
A0A452E1B1_BCL2L1-      --------------------------tggtccctga--------------
A0A8C2NR03_BCL2L1-      -----------------------------------a--------------
A0A452FWV3_BCL2L1-      --------------------------tggttcctga--------------
A0A8C2NR03_BCL2L1-      --------------------------ccacacatca--------------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C2N853_MCL1-01      --------------------------------------------------
A0A8C2N853_MCL1-02      --------------------------------------------------
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      caggcatcagcacaacagaccgaggtttcccacgagcccgataccgtgcc
A0A8C2R4Z3_BCL2L2-      caggcatcagcacaacagaccgaggtttcccacgagcccgataccgtgcc
A0A8C2R4Z3_BCL2L2-      caggcatcagcacaacagaccgaggtttcccacgagcccgataccgtgcc
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      caggcatcagcacaacagaccgaggtttcccacgagcccgataccgtgcc
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
A0A8C2NR03_BCL2L1-      --------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      --------aagttacaggaaagatctgtga--------------------
A0A8C2RKE2_BCL2A1-      --------aagttacaggaaagatctgtga--------------------
A0A8C2PEQ8_BCL2L10      --------cagcaataatcataatctacttctggataaaattatcaaatg
A0A8C2PEQ8_BCL2L10      --------cagcaataatcataatctacttctggataaaattatcggcta
A0A8C2PEQ8_BCL2L10      --------cagcaataatcataatctacttctggataaaattatc-----
A0A076FU27_BCL2-01      --------aaggcactg-------ctcagtctggccctggtgggcg----
A0A076FZV9_BCL2-01      --------aaggcactg-------ctcagtctggccctggtgggcg----
A0A452EV13_BCL2-01      --------aaggcactg-------ctcagtctggccctggtgggcg----
A0A8C2N853_MCL1-01      --------cagtcaata-------ct-agattgtatacagaaccag----
A0A8C2N853_MCL1-02      --------caggtgttg-------ct-gg---------agtaggag----
A0A8C2N853_MCL1-03      --------caggtgttg-------ct-gg---------agtaggag----
A0A452GA25_MCL1-01      --------caggtgttg-------ct-gg---------agtaggag----
A0A452GA25_MCL1-02      --------caggtgttg-------ct-gg---------agtaggag----
A0A8C2R4Z3_BCL2L2-      cgaaccaccaactacaa-------cagttcccgctctcgattctacagtg
A0A8C2R4Z3_BCL2L2-      cgaaccaccaactacaa-------cagttcccgctctcgattctacagtg
A0A8C2R4Z3_BCL2L2-      cgaaccaccaactacaa-------cagttcccgctctcgattctacagtg
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      cgaaccaccaactacaa-------cagttcccgctctcgattctacagtg
A0A452FHY1_BCL2L1-      --------cggctgtga-------ctttggctggg---ggatcaggactc
A0A452FHY1_BCL2L1-      --------cggctgtga-------ctttggctgggctcgctcttcaactc
A0A452E1B1_BCL2L1-      --------cggacgtga-------ctgtggctggtatggctctg------
A0A8C2NR03_BCL2L1-      --------cagccacan-------nnnnnnnnnnnnnnnnnnnn------
A0A452FWV3_BCL2L1-      --------cgggcatga-------ctgtggctggtgtggttctg------
A0A8C2NR03_BCL2L1-      --------cagg-------------------------------g------
                                                                          

A0A452EK63_BCL2A1-      --------------------------------------------------
A0A8C2RKE2_BCL2A1-      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      gatttattgtttctgagtcatc-----------------------cttgg
A0A8C2PEQ8_BCL2L10      cccag---------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      ---------------------------------------------cttgc
A0A076FZV9_BCL2-01      ---------------------------------------------cttgc
A0A452EV13_BCL2-01      ---------------------------------------------cttgc
A0A8C2N853_MCL1-01      ---------------------------------------------ctgat
A0A8C2N853_MCL1-02      ---------------------------------------------ctggt
A0A8C2N853_MCL1-03      ---------------------------------------------ctggt
A0A452GA25_MCL1-01      ---------------------------------------------ctggt
A0A452GA25_MCL1-02      ---------------------------------------------ctggt
A0A8C2R4Z3_BCL2L2-      gttttaacagcaggcc-----------------------------ccggg
A0A8C2R4Z3_BCL2L2-      gttttaacagcaggcc-----------------------------ccggg
A0A8C2R4Z3_BCL2L2-      gttttaacagcaggcc-----------------------------ccggg
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      gttttaacagcaggcc-----------------------------ccggg
A0A452FHY1_BCL2L1-      agcaggaaggcagctgtctctaaagataccc--------------cttgg
A0A452FHY1_BCL2L1-      atagtgactgttcctttcattacagtcattcatgttttgcacaagcttgt
A0A452E1B1_BCL2L1-      ---------------------------------------------ctggg
A0A8C2NR03_BCL2L1-      ---------------------------------------------nnnnn
A0A452FWV3_BCL2L1-      ---------------------------------------------ctggg
A0A8C2NR03_BCL2L1-      ---------------------------------------------ttggg
                                                                          

A0A452EK63_BCL2A1-      -----------------------------------aacattatgtcgtct
A0A8C2RKE2_BCL2A1-      -----------------------------------aacattatgtcgtct
A0A8C2PEQ8_BCL2L10      aggatttggaaaagggtattaaagtcttgacgtgccttgacctgtggaac
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A8C2PEQ8_BCL2L10      --------------------------------------------------
A0A076FU27_BCL2-01      atcaccctgggt-----------------------gcctatctgggccat
A0A076FZV9_BCL2-01      atcaccctgggt-----------------------gcctatctgggccat
A0A452EV13_BCL2-01      atcaccctgggt-----------------------gcctatctgggccat
A0A8C2N853_MCL1-01      ----------gt-----------------------aattgtatgcaactt
A0A8C2N853_MCL1-02      ----------tn-----------------------n---nnnnnnnnnnn
A0A8C2N853_MCL1-03      ----------tn-----------------------n---nnnnnnnnnnn
A0A452GA25_MCL1-01      ----------tt-----------------------g---gcatatctaat
A0A452GA25_MCL1-02      ----------tt-----------------------g---gcatatctaat
A0A8C2R4Z3_BCL2L2-      gtcgcgtctaca----ggggccgggctagagcgacatcatggtattcccc
A0A8C2R4Z3_BCL2L2-      gtcgcgtctaca----ggggccgggctagagcgacatcatggtattcccc
A0A8C2R4Z3_BCL2L2-      gtcgcgtctaca----ggggccgggctagagcgacatcatggt------t
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A8C2R4Z3_BCL2L2-      gtcgcgtctaca----ggggccgggctagagcgacatcatggtattcccc
A0A452FHY1_BCL2L1-      ctcaccttcccc-------------tctccccatgctcaag----cctac
A0A452FHY1_BCL2L1-      gttcccttcctt-------------ttgttaca-gctatagagaccttac
A0A452E1B1_BCL2L1-      cttgctcttcaa--------------------------------------
A0A8C2NR03_BCL2L1-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncttgt
A0A452FWV3_BCL2L1-      ctcgctcttcag-----------------------------------tcg
A0A8C2NR03_BCL2L1-      cc------------------------------------------------
                                                                          

A0A452EK63_BCL2A1-      gaagcaatactattga--------
A0A8C2RKE2_BCL2A1-      gaagcaatactattga--------
A0A8C2PEQ8_BCL2L10      caagtgacagagaaaagttgttaa
A0A8C2PEQ8_BCL2L10      -aagtga-----------------
A0A8C2PEQ8_BCL2L10      ---gtga-----------------
A0A076FU27_BCL2-01      aagtga------------------
A0A076FZV9_BCL2-01      aagtga------------------
A0A452EV13_BCL2-01      aagtga------------------
A0A8C2N853_MCL1-01      ggtgtag-----------------
A0A8C2N853_MCL1-02      aagatag-----------------
A0A8C2N853_MCL1-03      aagatag-----------------
A0A452GA25_MCL1-01      aagatag-----------------
A0A452GA25_MCL1-02      aagatag-----------------
A0A8C2R4Z3_BCL2L2-      ttactaa-----------------
A0A8C2R4Z3_BCL2L2-      ttactaa-----------------
A0A8C2R4Z3_BCL2L2-      tctgtag-----------------
A0A452ECF0_BCL2L2-      ------------------------
A0A8C2R4Z3_BCL2L2-      ttactaa-----------------
A0A452FHY1_BCL2L1-      ----tga-----------------
A0A452FHY1_BCL2L1-      aatttaa-----------------
A0A452E1B1_BCL2L1-      cacataa-----------------
A0A8C2NR03_BCL2L1-      aaaatga-----------------
A0A452FWV3_BCL2L1-      gaaatga-----------------
A0A8C2NR03_BCL2L1-      ----tag-----------------
                                                

© 1998-2022Legal notice