Dataset for CDS BCL-2-like of organism Gopherus evgoodei

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4W4P8_BCL2A1-      atgg----------------------------------------------
A0A8C4YAJ9_MCL1-01      atgt------tggcgctgaagcggaacgcggtgatcggcctcaacctgta
A0A8C4VT25_BCL2-01      atgg-----------------------------------ctcatcctggg
A0A8C4W8N7_BCL2L1-      atgaaatttacaagagcaaagccttctcaacacacagttctcaattggag
                        ***                                               

A0A8C4W4P8_BCL2A1-      -----------------------------------------------aaa
A0A8C4YAJ9_MCL1-01      ctgcgggggcggcccgacgctgcccccctccgcgccggcctcccccagcg
A0A8C4VT25_BCL2-01      ------aga-------------------------------------agag
A0A8C4W8N7_BCL2L1-      ctcctcagg-------------------------------------agag
                                                                          

A0A8C4W4P8_BCL2A1-      gctctgagtact------------gctatgtttactatttagtccaa---
A0A8C4YAJ9_MCL1-01      gcgcggggacccctcccgcccccgggcctgcggcggagggcgtccggccg
A0A8C4VT25_BCL2-01      gctatgataac---------------------cgggagatagt-------
A0A8C4W8N7_BCL2L1-      gatataagaactagcccaagcctgtttgctttcagaagctggtccgatag
                        *         *                         *    **       

A0A8C4W4P8_BCL2A1-      ----gattatct---gaaat------------------------acgttc
A0A8C4YAJ9_MCL1-01      gcgacgctgattggcggagcctcttggg----------gttccaacggtc
A0A8C4VT25_BCL2-01      ---------gct---gaagt------------------------acatcc
A0A8C4W8N7_BCL2L1-      gggcggtgaact---gagatttcccaggccagagctttctcccagcagct
                                   *   *                             *    

A0A8C4W4P8_BCL2A1-      ttc-----------------------------------------------
A0A8C4YAJ9_MCL1-01      attctgagggggcccgggcgctgattggctcccccgcagccgccccgtct
A0A8C4VT25_BCL2-01      attacaaa------------------------------------------
A0A8C4W8N7_BCL2L1-      actctagaggattgt-----ctgctcagggttcagatgtttgccttgact
                                                                          

A0A8C4W4P8_BCL2A1-      --------------------------------------------aggaac
A0A8C4YAJ9_MCL1-01      ctggtggccggggggccccggcccggcccgctgtggcggccggaagagga
A0A8C4VT25_BCL2-01      ------------------------------ctgtcacag-----agggga
A0A8C4W8N7_BCL2L1-      ccag----aggagagcagagtctggacctgctatcgcag-----agggga
                                                                    **    

A0A8C4W4P8_BCL2A1-      cacagct----------------------------------tggac----
A0A8C4YAJ9_MCL1-01      actggacggctgcgaccccgacgccgagcggatgggcccgccgggcgccg
A0A8C4VT25_BCL2-01      tatgattgggct---------------gccaatgaaaacagaggac----
A0A8C4W8N7_BCL2L1-      tacagctggagtcggttcgaa---ggggaggatgagatc--aggac----
                                                                  ** *    

A0A8C4W4P8_BCL2A1-      ----cagccccaagcagagttgctcatgtctta-----------------
A0A8C4YAJ9_MCL1-01      ccggcggctccctgcccagcaccccgcccgcggaggacgacgacgagctg
A0A8C4VT25_BCL2-01      ----cagtttc--accaaatctctctccccctactgctactg--------
A0A8C4W8N7_BCL2L1-      ----tgattct--gcagaa----------------gaggctg--------
                                      *  *                                

A0A8C4W4P8_BCL2A1-      ---agaca-------------------------cgctgcatcctt-----
A0A8C4YAJ9_MCL1-01      gacgggctgtaccaggactcgctggagctcatcagccgctacctgcggga
A0A8C4VT25_BCL2-01      ---ggacctcatctgaccatgctgggctgatgtctctgcctcctg-----
A0A8C4W8N7_BCL2L1-      ---agatggcaagtgtccctaatgggagtccatcctggcatcagggtgcc
                            *                                **  *        

A0A8C4W4P8_BCL2A1-      ----------------------------tctgcaaaag------------
A0A8C4YAJ9_MCL1-01      ggccgcggagctcggcgggc--ccg---gcggcaagaagctcctcaagcg
A0A8C4VT25_BCL2-01      agccccctggctc----ggctgctg---ctagtaacgtgccccttgg--t
A0A8C4W8N7_BCL2L1-      agccacatagtgaatggggctgctgggcacagtaacag---ccttga--a
                                                       * **               

A0A8C4W4P8_BCL2A1-      ----------------------------------gaaaatgaagagagtc
A0A8C4YAJ9_MCL1-01      gctgctgagcgggccgcggggcgccggccccgccgccatggagaaggcgc
A0A8C4VT25_BCL2-01      g---atgggctgcgccca----------------gcaccgcaggctgttc
A0A8C4W8N7_BCL2L1-      gcccatgaaagggttcca----------------gcaactggagtgaggc
                                                          *              *

A0A8C4W4P8_BCL2A1-      tgaaaccatgtttggacacatttgatattacctctgtagatgctgccaga
A0A8C4YAJ9_MCL1-01      tggag--acgctgcggagggtcggcgacggcgtcattgagaagcaccaga
A0A8C4VT25_BCL2-01      tcttg--gctctgtgccaagctggagatgaattttcccgtcgctaccaca
A0A8C4W8N7_BCL2L1-      ---ag--gcgctgagagaggcaggagatgagtttgaattgaggtatcgga
                                   *  *        *  *     *             *  *

A0A8C4W4P8_BCL2A1-      agaattt--------------------------tcactc-----------
A0A8C4YAJ9_MCL1-01      tcgccttccaagggatgcttcggaagctagacatca----------agaa
A0A8C4VT25_BCL2-01      gagattttgcccagatgtctggccagctgcacttgaccccattcacggcc
A0A8C4W8N7_BCL2L1-      gggctttcagtgacctcacttcccaactccacatcactcctggcacggca
                             **                          * *              

A0A8C4W4P8_BCL2A1-      ----------------aagtcatggata------------aagaatttgc
A0A8C4YAJ9_MCL1-01      tgaggatgatctga--agtcagtgactgccgttgcaacccatgttttcag
A0A8C4VT25_BCL2-01      agggggcgctttgtggcggtggtggagg------------agctgttccg
A0A8C4W8N7_BCL2L1-      taccagagctttgagcaggtagtgaatg------------aactcttccg
                                              **                *    **   

A0A8C4W4P8_BCL2A1-      tgatggaaacactaactggggacggattttgacaatatttatgtttgg--
A0A8C4YAJ9_MCL1-01      tgatggagtaacaaactggggtagaattgtgacactcatctcttttggtg
A0A8C4VT25_BCL2-01      agatggggt---taactggggaaggatcgtggccttctttgaatttgg--
A0A8C4W8N7_BCL2L1-      ggacggagt---gaactgggggcgcattgtggcttttttctcctttgg--
                         ** **       ********  * **  ** *  *  *    *****  

A0A8C4W4P8_BCL2A1-      ----aggaattctttctaagaagcttcaagaacacagagttcagcttaca
A0A8C4YAJ9_MCL1-01      cctttgttgcaaaac-------acctgaagagcataaa---------cca
A0A8C4VT25_BCL2-01      ----tggtgtgatgt-------gtgtggagagcgttaa---------tcg
A0A8C4W8N7_BCL2L1-      ----aggagccctgt-------gtgtggagagtgtcga---------caa
                             *                   *  ***      *            

A0A8C4W4P8_BCL2A1-      ggaga---------aaataaaaagcagatttcttatttcat---------
A0A8C4YAJ9_MCL1-01      ggaga---------------attgca------tcaacacactagcaggga
A0A8C4VT25_BCL2-01      ggagatgtcgcctcttgtggacagca------ttgctgtgt------gga
A0A8C4W8N7_BCL2L1-      ggagatgcaggtgttggttggacgca------tcgtctcat------gga
                        *****                  ***      *                 

A0A8C4W4P8_BCL2A1-      -cacagagtacatt------ataaacaccaaggctgagtggatagaggca
A0A8C4YAJ9_MCL1-01      tcatcacagatgtgcttgtcacaggcaaacgagat---tggctagttaac
A0A8C4VT25_BCL2-01      tgactgaatacctg------aacagacacctacacaactggatccaggac
A0A8C4W8N7_BCL2L1-      tgaccacttacctg------actgaccacctagatccctggatccaagag
                          *      *  *       *                 *** *       

A0A8C4W4P8_BCL2A1-      aatggaggttgggtaagtttcagtgctgtattttataaccatttttcact
A0A8C4YAJ9_MCL1-01      caaagaggctgggagggatttgttgaattcttccgtgtaga--ggatcta
A0A8C4VT25_BCL2-01      aacggaggctgggatgcctttgtggaattgt---acggcag--gaaca-t
A0A8C4W8N7_BCL2L1-      aatggcggttgggagcggtttgtggatctct---atgggaa--tgacgct
                         *  * ** ****     **    *   * *                   

A0A8C4W4P8_BCL2A1-      gctatctagatcagaagaatttt------cattaataaatttttttaaaa
A0A8C4YAJ9_MCL1-01      gaaggtagcatcaggaatgttctggtggcttttgcaggctttgct-ggac
A0A8C4VT25_BCL2-01      gaggcctgtgtttgatttctcctggatctctttgaagactatcctaagtc
A0A8C4W8N7_BCL2L1-      gctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgac
                        *            *                 *       *    *     

A0A8C4W4P8_BCL2A1-      tgt----------------------------------tcttt--------
A0A8C4YAJ9_MCL1-01      tgg--------------gagcaagc------ttggcctatatgatgcga-
A0A8C4VT25_BCL2-01      tgg-----ctctggtgggagcttgcatcaccctgggcgcttatctgggac
A0A8C4W8N7_BCL2L1-      cggggcgactctggcaggag--tgc-tcctgctgggctctctgctgagcc
                         *                                     *          

A0A8C4W4P8_BCL2A1-      -----taa
A0A8C4YAJ9_MCL1-01      -----tga
A0A8C4VT25_BCL2-01      ataagtga
A0A8C4W8N7_BCL2L1-      gcaagtaa
                             * *

© 1998-2022Legal notice