Dataset for CDS MCL-1 of organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W5KYB3_MCL1-01      atg--------------------------------taccacgtt------
A0A4W5LF91_MCL1-01      atg--------------------------------taccacgtt------
A0A4W5LZB2_MCL1-01      atg--------------------------------aataaca--------
A0A4W5Q5Q2_MCL1-01      gca--------------------------------gataaagtc------
A0A4W5Q5Q2_MCL1-02      atg--------------------------------gaaacagccaagcgg
A0A4W5QGT1_MCL1-01      atgagtctgtcgaagtccattgcacgagccacaactacgatgttgcattt
A0A4W5LP06_MCL1-01      atgagtctgtcg------gttacacgagccacaactacgatgtggcatta
A0A4W5LP06_MCL1-02      atgagtctgtcg------gttacacgagccacaactacgatgtggcatta

A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LF91_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      aaaacgctcctgagtctcttcgacggcacaggcagtatttgcaagccctt
A0A4W5QGT1_MCL1-01      tcaaaatgga------ggatcttcgtaccttgctaatgatgctagccctt
A0A4W5LP06_MCL1-01      tcaaaatggagtcttcggaccttcgtactctgc---tggtgctagccctt
A0A4W5LP06_MCL1-02      tcaaaatggagtcttcggaccttcgtactctgc---tggtgctagccctt

A0A4W5KYB3_MCL1-01      --------------------------------ccacatacggttgacaaa
A0A4W5LF91_MCL1-01      --------------------------------ccacatacggttgacaaa
A0A4W5LZB2_MCL1-01      ---------------------------------cccatggagttg-----
A0A4W5Q5Q2_MCL1-01      --------------------------------------acagttaac---
A0A4W5Q5Q2_MCL1-02      cgttgaagctggctggaccgtgcgaagactagacatcgacagtcgacacg
A0A4W5QGT1_MCL1-01      tgt----gctatttc---aacgggg---------ctggggcgtcaccgac
A0A4W5LP06_MCL1-01      tgt----gctatttcgcgactggggccgtatgtcctggggcgtcaccgaa
A0A4W5LP06_MCL1-02      tgt----gctatttcgcgactggggccgtatgtcctggggcgtcaccgaa

A0A4W5KYB3_MCL1-01      cacaaatgctg-----gacgtgtaagctcgaaatcgacagctt-------
A0A4W5LF91_MCL1-01      cacaaatgctg-----gacgtgtaagctcgaaatcgacagctt-------
A0A4W5LZB2_MCL1-01      ------------------catgt---------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      gtgctgatatc-----gttgtggacatacgaaagtgggaccct-------
A0A4W5QGT1_MCL1-01      gtctaaagtg------gacttgggaaatgggactggcgatactccaccac
A0A4W5LP06_MCL1-01      gtcaaaagtggatactgacttgggtaatgggactggcgacactccaccac
A0A4W5LP06_MCL1-02      gtcaaaagtggatactgacttgggtaatgggactggcgacactccaccac

A0A4W5KYB3_MCL1-01      -------------------------tgtggagaacgataccct-------
A0A4W5LF91_MCL1-01      -------------------------tgtggagaacgataccct-------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      -------------------------ttggactctgtcagtgct-------
A0A4W5QGT1_MCL1-01      gacccacgacgttaggagtgagtgtcgtgaaaagcaacgtcctcgataat
A0A4W5LP06_MCL1-01      gacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaat
A0A4W5LP06_MCL1-02      gacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaat

A0A4W5KYB3_MCL1-01      -------------------------actgggtgagcacatctacc--acg
A0A4W5LF91_MCL1-01      -------------------------actgggtgagcacatctaccacacg
A0A4W5LZB2_MCL1-01      -----------------------------------------------acg
A0A4W5Q5Q2_MCL1-01      -------------------------cgagcccgggcaggtgaca---atg
A0A4W5Q5Q2_MCL1-02      -------------------------agagctcggatgaataacacccatg
A0A4W5QGT1_MCL1-01      catttgtcagaccgaagcaacaatgacgactctgacgattctttgccgtg
A0A4W5LP06_MCL1-01      catttgtcagacctaagcaacaatgacgactctggcgattctttgccatg
A0A4W5LP06_MCL1-02      catttgtcagacctaagcaacaatgacgactctggcgattctttgccatg

A0A4W5KYB3_MCL1-01      ta---------------tacaacacaggcggacactgcaggtacctcgcg
A0A4W5LF91_MCL1-01      ca---------------cacaa-------------tgaagatatc-----
A0A4W5LZB2_MCL1-01      ca---------------cacaa-------------tgaagatatc-----
A0A4W5Q5Q2_MCL1-01      ga---------------aacagccaa-gcgg----aaaacatatc-----
A0A4W5Q5Q2_MCL1-02      gagttgcatgtgtatataagtgccaacgctg----taaagggatc-----
A0A4W5QGT1_MCL1-01      cactccccagatggcgtcagaatgtgggc------ctgagctatc-----
A0A4W5LP06_MCL1-01      cactccagagatggcgtcagaatgtgggc------ctgaactatc-----
A0A4W5LP06_MCL1-02      cactccagagatggcgtcagaatgtgggc------ctgaactatc-----
                         *                *                   *   * *     

A0A4W5KYB3_MCL1-01      gacaggtac-----------accaatcgagaagaggagataatgctcata
A0A4W5LF91_MCL1-01      -------ac-----------atca--------------------------
A0A4W5LZB2_MCL1-01      -------ac-----------atca--------------------------
A0A4W5Q5Q2_MCL1-01      -------ac-----------atca--------------------------
A0A4W5Q5Q2_MCL1-02      -------ctgagtagttgtgagct--------------------------
A0A4W5QGT1_MCL1-01      gaattgtcc-----------atcg--------------------------
A0A4W5LP06_MCL1-01      gaattgtcc-----------atcg--------------------------
A0A4W5LP06_MCL1-02      gaattgtcc-----------atcg--------------------------
                                            * *                           

A0A4W5KYB3_MCL1-01      ctggggaaggaacggtacaggaagggaacagtcgcgttccctgaaaccat
A0A4W5LF91_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------

A0A4W5KYB3_MCL1-01      ggaaacctgtgatgctctggacacagacaccaggcaacttatgacatgtg
A0A4W5LF91_MCL1-01      ggaaacctgtgatgctctggacacagacaccaggcaacttatgacatgtg
A0A4W5LZB2_MCL1-01      ggaaacctgtgatgctctggacacagacaccaggcaacttatgacatgtg
A0A4W5Q5Q2_MCL1-01      ggaaacctgtgatgctctggacacagacaccaggcaacttattaaatgtg
A0A4W5Q5Q2_MCL1-02      tgaaacctgtgatgctctggacacagacaccaggcaacttattaaatgtg
A0A4W5QGT1_MCL1-01      ----ggcgatgaagtattggaacatgataccagacaactaattgaacatt
A0A4W5LP06_MCL1-01      ----gccgatgaagtattggaacatgataccagacaagtaattgaagact
A0A4W5LP06_MCL1-02      ----gccgatgaagtattggaacatgataccagacaagtaattgaagact
                              *  *** *   ****    ** ***** *** * **   *    

A0A4W5KYB3_MCL1-01      tcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaa
A0A4W5LF91_MCL1-01      tcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaa
A0A4W5LZB2_MCL1-01      tcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaa
A0A4W5Q5Q2_MCL1-01      tcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaa
A0A4W5Q5Q2_MCL1-02      tcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaa
A0A4W5QGT1_MCL1-01      ttttgagggactacacaggactgtctcagcctcgttggaagcaaagcaag
A0A4W5LP06_MCL1-01      tattgggggactacacaggactgtctcaacctcgttggaaggaaagcaag
A0A4W5LP06_MCL1-02      tattgggggactacacaggactgtctcaacctcgttggaaggaaagcaag
                        *  *  *  * ** ** *****     * * * * *****  ******* 

A0A4W5KYB3_MCL1-01      gctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacag
A0A4W5LF91_MCL1-01      gctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacag
A0A4W5LZB2_MCL1-01      gctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacag
A0A4W5Q5Q2_MCL1-01      gctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacag
A0A4W5Q5Q2_MCL1-02      gctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacag
A0A4W5QGT1_MCL1-01      cctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccg
A0A4W5LP06_MCL1-01      gctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaagcaccg
A0A4W5LP06_MCL1-02      gctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaagcaccg
                         ****  * ** ****   **** **     *  ** * *  ** *** *

A0A4W5KYB3_MCL1-01      atacacatacaatggtatgatcaacacactctacatggatgacagagggg
A0A4W5LF91_MCL1-01      atacacatacaatggtatgatcaacacactctacatggatgacagagggg
A0A4W5LZB2_MCL1-01      atacacatacaatggtatgatcaacacactctacatggatgacagagggg
A0A4W5Q5Q2_MCL1-01      atacacatacaatggtatgatcaacacactctacatgtatgacagagggg
A0A4W5Q5Q2_MCL1-02      atacacatacaatggtatgatcaacacactctacatgtatgacagagggg
A0A4W5QGT1_MCL1-01      atacgcattcaatggtatgatcgccaaacttgacttggatgatcgatgcg
A0A4W5LP06_MCL1-01      atacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcg
A0A4W5LP06_MCL1-02      atacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcg
                        **** *** *************  ** ***  ** *  ****  ** * *

A0A4W5KYB3_MCL1-01      atgatgtgaggtttgtcagtacactagcccatatcatctttcgagacggg
A0A4W5LF91_MCL1-01      atgatgtgaggtttgtcagtacactagcccatatcatctttcgagacggg
A0A4W5LZB2_MCL1-01      atgatgtgaggtttgtcagtacactagcccatatcatctttcgagacggg
A0A4W5Q5Q2_MCL1-01      atgatgtgaggtttgtcagtacactagcccatatcatctttcgagacggg
A0A4W5Q5Q2_MCL1-02      atgatgtgaggtttgtcagtacactagcccatatcatctttcgagacggg
A0A4W5QGT1_MCL1-01      atgacatgcgcgtcatcaattctgtggccaagaccatgttcggtgatagg
A0A4W5LP06_MCL1-01      atgacatgagcttcatcaaatctgtggccaagaccctgttcagtgatggg
A0A4W5LP06_MCL1-02      atgacatgagcttcatcaaatctgtggccaagaccctgttcagtgatggg
                        ****  ** *  *  ***   *  * *** * * * * **  * **  **

A0A4W5KYB3_MCL1-01      accgtcaactggggccgcgttgccagcctgacatcatttggggctgcggt
A0A4W5LF91_MCL1-01      accgtcaactggggccgcgttgccagcctgacatcatttggggctgcggt
A0A4W5LZB2_MCL1-01      accgtcaactggggccgcgttgccagcctgacatcatttggggctgcggt
A0A4W5Q5Q2_MCL1-01      accgtcaactggggccgcgttgccagcctgacatcatttggggctgcggt
A0A4W5Q5Q2_MCL1-02      accgtcaactggggccgcgttgccagcctgacatcatttggggctgcggt
A0A4W5QGT1_MCL1-01      gtcacgaactggggtcgcatcgccagcctggtggcatttggagcagtggt
A0A4W5LP06_MCL1-01      accacgaactggggtcgcatcgccagcctggtggcattcggagcagtggt
A0A4W5LP06_MCL1-02      accacgaactggggtcgcatcgccagcctggtggcattcggagcagtggt
                          *   ******** *** * *********    **** ** ** * ***

A0A4W5KYB3_MCL1-01      gtgtcagtacttgaaagacgaggggagagacaactgtgtggaggcggtgg
A0A4W5LF91_MCL1-01      gtgtcagtacttgaaagacgaggggagagacaactgtgtggaggcggtgg
A0A4W5LZB2_MCL1-01      gtgtcagtacttgaaagacgaggggagagacaactgtgtggaggcggtgg
A0A4W5Q5Q2_MCL1-01      gtgtcagtacttgaaagacgaggggagagacaactgtgtggagttggtgg
A0A4W5Q5Q2_MCL1-02      gtgtcagtacttgaaagacgaggggagagacaactgtgtggagttggtgg
A0A4W5QGT1_MCL1-01      gagccagcacctgaaggagaatggcaggggacactgcgttgatttggtgg
A0A4W5LP06_MCL1-01      gagccagcaactgaaggagaggagcaggggacactgcattgggttggtgg
A0A4W5LP06_MCL1-02      gagccagcaactgaaggagaggagcaggggacactgcattgggttggtgg
                        * * *** *  **** **     * ** *   ****  * *    *****

A0A4W5KYB3_MCL1-01      gagaggagatatcagcatacctggtcactcaccacaaggactggctagtc
A0A4W5LF91_MCL1-01      gagaggagatatcagcatacctggtcactcaccacaaggactggctagtc
A0A4W5LZB2_MCL1-01      gagaggagatatcagcatacctggtcactcaccacaaggactggctagtc
A0A4W5Q5Q2_MCL1-01      gagaggagatatcagcatacctggtcactcaccacaaggactggctagtc
A0A4W5Q5Q2_MCL1-02      gagaggagatatcagcatacctggtcactcaccacaaggactggctagtc
A0A4W5QGT1_MCL1-01      gccaagagattgccacatacctcctctctgaccaaagggactggctggtc
A0A4W5LP06_MCL1-01      gccaagagatcgccacatacctcctctctgaccaaagggactggctagtc
A0A4W5LP06_MCL1-02      gccaagagatcgccacatacctcctctctgaccaaagggactggctagtc
                        *  * *****  *  *******  ** ** **** * ********* ***

A0A4W5KYB3_MCL1-01      aaacacaactcctggaacggtttcgtggagttcttttcagtagcagaaac
A0A4W5LF91_MCL1-01      aaacacaactcctggaacggtttcgtggagttcttttcagtagcagaaac
A0A4W5LZB2_MCL1-01      aaacacaactcctggaacggtttcgtggagttcttttcagtagcagaaac
A0A4W5Q5Q2_MCL1-01      aaacacaactcctggaacggtttcgtggagttcttttcagtagcagaacc
A0A4W5Q5Q2_MCL1-02      aaacacaactcctggaacggtttcgtggagttcttttcagtagcagaacc
A0A4W5QGT1_MCL1-01      aaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatcc
A0A4W5LP06_MCL1-01      aaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatcc
A0A4W5LP06_MCL1-02      aaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatcc
                        *** ****  * ***** ** ** ** ** ******   **   ***  *

A0A4W5KYB3_MCL1-01      ggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggta
A0A4W5LF91_MCL1-01      ggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggta
A0A4W5LZB2_MCL1-01      ggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggta
A0A4W5Q5Q2_MCL1-01      ggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggta
A0A4W5Q5Q2_MCL1-02      ggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggta
A0A4W5QGT1_MCL1-01      agagtcctcagtaaggaacaccctcctagcctttgctggagttgctggga
A0A4W5LP06_MCL1-01      agagtcctctgtaaggaacaccctcctagcctttgctggatttgctggga
A0A4W5LP06_MCL1-02      agagtcctctgtaaggaacaccctcctagcctttgctggatttgctggga
                         ******      ******* * **    ** ***  *** * ***** *

A0A4W5KYB3_MCL1-01      ttggggcagcaatgaccttgttagctat----------------------
A0A4W5LF91_MCL1-01      ttggggcagcaatgaccttgttagctat----------------------
A0A4W5LZB2_MCL1-01      ttggggcagcaatgaccttgttagctat----------------------
A0A4W5Q5Q2_MCL1-01      ttggggcagcaatgaccttgttagttat----------------------
A0A4W5Q5Q2_MCL1-02      ttggggcagcaatgaccttgttagttat----------------------
A0A4W5QGT1_MCL1-01      ttggggcaacacttgccatgttgatcag----------------------
A0A4W5LP06_MCL1-01      ttggggcaacactcgccatgttgatcag----------------------
A0A4W5LP06_MCL1-02      ttggggcaacactcgccatgttgatcagatcccaccatccctctctgctg
                        ******** ** *  ** ****    *                       

A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LF91_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-01      ------------------------------------------gaa-----
A0A4W5LP06_MCL1-02      tcctccgcagtttttgagctttctccattgataatgaatgaagaacggcg

A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LF91_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-01      ------------------------ttcag---------cagat-------
A0A4W5LP06_MCL1-02      gcttatttcatctgaggcacctctttcagatagttttccagatggaaatg

A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LF91_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      caatatatagatctgtactcgattctctattctacaaggcaaagggtctt

A0A4W5KYB3_MCL1-01      -----------gtga
A0A4W5LF91_MCL1-01      -----------gtga
A0A4W5LZB2_MCL1-01      -----------gtga
A0A4W5Q5Q2_MCL1-01      -----------gtga
A0A4W5Q5Q2_MCL1-02      -----------gtga
A0A4W5QGT1_MCL1-01      -----------gtga
A0A4W5LP06_MCL1-01      --------tag----
A0A4W5LP06_MCL1-02      ggctgttgtaggtga

© 1998-2021Legal notice