Dataset for CDS MCL-1 of organism Hucho hucho

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A4W5KYB3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=765 residues).
atgtaccacgttccacatacggttgacaaacacaaatgctggacgtgtaagctcgaaatcgacagctttgtggagaacga
taccctactgggtgagcacatctaccacgtatacaacacaggcggacactgcaggtacctcgcggacaggtacaccaatc
gagaagaggagataatgctcatactggggaaggaacggtacaggaagggaacagtcgcgttccctgaaaccatggaaacc
tgtgatgctctggacacagacaccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtg
gaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggta
tgatcaacacactctacatggatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagac
gggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggag
agacaactgtgtggaggcggtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacaca
actcctggaacggtttcgtggagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtc
ggattggctggtattggggcagcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5LF91_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=666 residues).
atgtaccacgttccacatacggttgacaaacacaaatgctggacgtgtaagctcgaaatcgacagctttgtggagaacga
taccctactgggtgagcacatctaccacacgcacacaatgaagatatcacatcaggaaacctgtgatgctctggacacag
acaccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaagctctg
tcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggtatgatcaacacactctacat
ggatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtcaactggggcc
gcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggagagacaactgtgtggaggcg
gtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacacaactcctggaacggtttcgt
ggagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggtattgggg
cagcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5LP06_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=879 residues).
atgagtctgtcggttacacgagccacaactacgatgtggcattatcaaaatggagtcttcggaccttcgtactctgctgg
tgctagccctttgtgctatttcgcgactggggccgtatgtcctggggcgtcaccgaagtcaaaagtggatactgacttgg
gtaatgggactggcgacactccaccacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaatcat
ttgtcagacctaagcaacaatgacgactctggcgattctttgccatgcactccagagatggcgtcagaatgtgggcctga
actatcgaattgtccatcggccgatgaagtattggaacatgataccagacaagtaattgaagacttattgggggactaca
caggactgtctcaacctcgttggaaggaaagcaaggctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaag
caccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagcttcatcaaatctgt
ggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcc
agcaactgaaggagaggagcaggggacactgcattgggttggtgggccaagagatcgccacatacctcctctctgaccaa
agggactggctagtcaaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatccagagtcctctgtaag
gaacaccctcctagcctttgctggatttgctgggattggggcaacactcgccatgttgatcaggaattcagcagattag
>gnl|bcl2dbcds|A0A4W5LP06_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=1050 residues).
atgagtctgtcggttacacgagccacaactacgatgtggcattatcaaaatggagtcttcggaccttcgtactctgctgg
tgctagccctttgtgctatttcgcgactggggccgtatgtcctggggcgtcaccgaagtcaaaagtggatactgacttgg
gtaatgggactggcgacactccaccacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaatcat
ttgtcagacctaagcaacaatgacgactctggcgattctttgccatgcactccagagatggcgtcagaatgtgggcctga
actatcgaattgtccatcggccgatgaagtattggaacatgataccagacaagtaattgaagacttattgggggactaca
caggactgtctcaacctcgttggaaggaaagcaaggctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaag
caccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagcttcatcaaatctgt
ggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcc
agcaactgaaggagaggagcaggggacactgcattgggttggtgggccaagagatcgccacatacctcctctctgaccaa
agggactggctagtcaaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatccagagtcctctgtaag
gaacaccctcctagcctttgctggatttgctgggattggggcaacactcgccatgttgatcagatcccaccatccctctc
tgctgtcctccgcagtttttgagctttctccattgataatgaatgaagaacggcggcttatttcatctgaggcacctctt
tcagatagttttccagatggaaatgcaatatatagatctgtactcgattctctattctacaaggcaaagggtcttggctg
ttgtaggtga
>gnl|bcl2dbcds|A0A4W5LZB2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=585 residues).
atgaataacacccatggagttgcatgtacgcacacaatgaagatatcacatcaggaaacctgtgatgctctggacacaga
caccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaagctctgt
caacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggtatgatcaacacactctacatg
gatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtcaactggggccg
cgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggagagacaactgtgtggaggcgg
tgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacacaactcctggaacggtttcgtg
gagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggtattggggc
agcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5Q5Q2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=789 residues).
atggaaacagccaagcggaaaacgctcctgagtctcttcgacggcacaggcagtatttgcaagcccttcgttgaagctgg
ctggaccgtgcgaagactagacatcgacagtcgacacggtgctgatatcgttgtggacatacgaaagtgggaccctttgg
actctgtcagtgctagagctcggatgaataacacccatggagttgcatgtgtatataagtgccaacgctgtaaagggatc
ctgagtagttgtgagcttgaaacctgtgatgctctggacacagacaccaggcaacttattaaatgtgtcctaggacaata
tacgggacttctgaaacgtgggtggaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggaga
aacacagatacacatacaatggtatgatcaacacactctacatgtatgacagaggggatgatgtgaggtttgtcagtaca
ctagcccatatcatctttcgagacgggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtg
tcagtacttgaaagacgaggggagagacaactgtgtggagttggtgggagaggagatatcagcatacctggtcactcacc
acaaggactggctagtcaaacacaactcctggaacggtttcgtggagttcttttcagtagcagaaccggagtccagatcg
aggaacatcatcgcgacccttgtcggattggctggtattggggcagcaatgaccttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5Q5Q2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=606 residues).
gcagataaagtcacagttaaccgagcccgggcaggtgacaatggaaacagccaagcggaaaacatatcacatcaggaaac
ctgtgatgctctggacacagacaccaggcaacttattaaatgtgtcctaggacaatatacgggacttctgaaacgtgggt
ggaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggt
atgatcaacacactctacatgtatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgaga
cgggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgagggga
gagacaactgtgtggagttggtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacac
aactcctggaacggtttcgtggagttcttttcagtagcagaaccggagtccagatcgaggaacatcatcgcgacccttgt
cggattggctggtattggggcagcaatgaccttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5QGT1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=852 residues).
atgagtctgtcgaagtccattgcacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtaccttgctaa
tgatgctagccctttgtgctatttcaacggggctggggcgtcaccgacgtctaaagtggacttgggaaatgggactggcg
atactccaccacgacccacgacgttaggagtgagtgtcgtgaaaagcaacgtcctcgataatcatttgtcagaccgaagc
aacaatgacgactctgacgattctttgccgtgcactccccagatggcgtcagaatgtgggcctgagctatcgaattgtcc
atcgggcgatgaagtattggaacatgataccagacaactaattgaacattttttgagggactacacaggactgtctcagc
ctcgttggaagcaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatacgcattc
aatggtatgatcgccaaacttgacttggatgatcgatgcgatgacatgcgcgtcatcaattctgtggccaagaccatgtt
cggtgatagggtcacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctgaaggaga
atggcaggggacactgcgttgatttggtgggccaagagattgccacatacctcctctctgaccaaagggactggctggtc
aaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaacaccctcctagc
ctttgctggagttgctgggattggggcaacacttgccatgttgatcaggtga
© 1998-2020Legal notice