Dataset for CDS BAX of Organism Chinchilla lanigera

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C2VI87_BAX-01 BCL2-associated X gene OS=[Eukaryota] Chinchilla lanigera GN=BAX (length=543 residues).
cccaccagctctgagcacatcatgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcacatggg
cggggacaccctggagctggccatggagcaggcgccccaggacgcgtccaccaagaagctgagcgagtgtctcaagcgga
ttggggacgaactggacagcaatatggagctgcagaggatgattgcggctgtggacacagactcgccccgagaggtcttt
ttccgagtggccgctgaaatgtttgctgatggcaacttcaactggggccgggttgttgcccttttctattttgccagcaa
actggtgctcaaggcgctgtgtaccaaggtacccgagctgatcaggaccattatgggctggacactggacttcctccgag
accggctgctgggctggatccaggaccagggtggttgggacggcctcctctcctactttggaaccccgacctggcagacg
gtgaccatctttgtggccggtgtgctcactgcctcgctcaccatctggaagaacatgggctga
>gnl|bcl2dbcds|A0A8C2VI87_BAX-02 BCL2-associated X gene OS=[Eukaryota] Chinchilla lanigera GN=BAX (length=186 residues).
cccaccagctctgagcacatcatgaagacaggggcccttttgcttcaggggatgattgcggctgtggacacagactcgcc
ccgagaggtctttttccgagtggccgctgaaatgtttgctgatggcaacttcaactggggccgggttgttgcccttttct
attttgccagcaaactggtgctcaag
© 1998-2023Legal notice