Dataset for CDS BAX of Organism Cyclopterus lumpus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2WGS9_BAX-01      atggc----cgaccgcggtgaagcggggagag--aagacggagaccggga
A0A8C2ZB73_BAX-01      atggcatcacacccgggaggaggcgatgaaggcaataacaaagaccag--
A0A8C2ZB73_BAX-02      atggcatcacacccgggaggaggcgatgaaggt----------accag--
                       *****    *  *** *  ** ***  **  *           *** *  

A0A8C2WGS9_BAX-01      gcctcagggcgccgagggtgg-------ggaagatgtaatcgatgacccc
A0A8C2ZB73_BAX-01      --ctactggaactaggagctgttttgttaaaagatttcatctacaagc--
A0A8C2ZB73_BAX-02      --ct-----------------------------atttcatctacaagc--
                         **                             ** * *** *  * *  

A0A8C2WGS9_BAX-01      ataatggagcagggagcagtggtcctcagagggtacgtggtggcacttgt
A0A8C2ZB73_BAX-01      -----------gggttcagcg-------------acatggaggc------
A0A8C2ZB73_BAX-02      -----------gggttcagcg-------------acatggaggc------
                                  ***  *** *             ** *** ***      

A0A8C2WGS9_BAX-01      aaacgcagaggagcccactcgacacctgtcctctgagcagctgggaggaa
A0A8C2ZB73_BAX-01      -aatactgaggtgacca----ggacc-----------cagctgggtggag
A0A8C2ZB73_BAX-02      -aatactgaggtgacca----ggacc-----------cagctgggtggag
                        **  * **** * ***      ***           ******** *** 

A0A8C2WGS9_BAX-01      ggcccaacgaacaacacgaaccacaggtcaaagaggtggtggagcagctg
A0A8C2ZB73_BAX-01      ta------gagctgtgtgaccccaaccacaagaagctggcccagtgcctg
A0A8C2ZB73_BAX-02      ta------gagctgtgtgaccccaaccacaagaagctggcccagtgcctg
                               ** *     ** **  *   ***  ** ***   **   ***

A0A8C2WGS9_BAX-01      ctcaagatcgcagatgacatcaacaggaatgccgagctccaacgactgat
A0A8C2ZB73_BAX-01      cagcagattggagacgagttggatggaaatgtagagctgcacaaaatgtt
A0A8C2ZB73_BAX-02      cagcagattggagacgagttggatggaaatgtagagctgcacaaaatgtt
                       *   **** * *** **  *  *  * ****  ***** **   * ** *

A0A8C2WGS9_BAX-01      caaccaggttcagggcaactgtgctcaggagatttttatgaaggtggcca
A0A8C2ZB73_BAX-01      aaacgactcttcgctcagtcccacaaaagaaatattcatgaaagttagcg
A0A8C2ZB73_BAX-02      aaacgactcttcgctcagtcccacaaaagaaatattcatgaaagttagcg
                        *** *   *  *  **      *  * ** ** ** ***** **   * 

A0A8C2WGS9_BAX-01      cgagcatcttcactgagggca---tcaactggggtcgagtggtggctctc
A0A8C2ZB73_BAX-01      ttgagatcttttcagatggaaaattcaactggggcagggtggttgcactg
A0A8C2ZB73_BAX-02      ttgagatcttttcagatggaaaattcaactggggcagggtggttgcactg
                            *****  * ** ** *   **********  * ***** ** ** 

A0A8C2WGS9_BAX-01      ttccatctggcctacagactcatatacaaggcactgaccaccgatcgcct
A0A8C2ZB73_BAX-01      ttctactttgcctgtcgactcgtcatcaaggctcttgtgacccacattcc
A0A8C2ZB73_BAX-02      ttctactttgcctgtcgactcgtcatcaaggctcttgtgacccacattcc
                       *** *  * ****   ***** *   ****** **    *** *    * 

A0A8C2WGS9_BAX-01      tgagaacatccgaataatcatcagctgggt---------tctccaggtca
A0A8C2ZB73_BAX-01      tgatatcatcagaacaataatcaactggacgatggactacctccaggaaa
A0A8C2ZB73_BAX-02      tgatatcatcagaacaataatcaactggacgatggactacctccaggaaa
                       *** * **** *** *** **** ****            *******  *

A0A8C2WGS9_BAX-01      tcagagagcaactctacccctggctcgtacagcagggaggctgggtgggg
A0A8C2ZB73_BAX-01      at-gtgatcaa--------ctggatcagggatcaaggtggctgggagggt
A0A8C2ZB73_BAX-02      at-gtgatcaa--------ctggatcagggatcaaggtggctgggagggt
                          * ** ***        **** **    * ** ** ******* *** 

A0A8C2WGS9_BAX-01      gt--gatcca----tgacttttctcggtggaggacggt---agccatcgt
A0A8C2ZB73_BAX-01      atccgatcccacctgggcacacccacatggcagacggtgggagttttcct
A0A8C2ZB73_BAX-02      atccgatcccacctgggcacacccacatggcagacggtgggagttttcct
                        *  *****      * *    *    ***  ******   **   ** *

A0A8C2WGS9_BAX-01      ggcatcagtagcattggtggcagccctcgtttact-----acaggaagac
A0A8C2ZB73_BAX-01      ggc--------cggtgttctcaccactgttttagttattcgcaagatg--
A0A8C2ZB73_BAX-02      ggc--------cggtgttctcaccactgttttagttattcgcaagatg--
                       ***        *  ** *  ** * **  **** *      ** ** *  

A0A8C2WGS9_BAX-01      acgctga
A0A8C2ZB73_BAX-01      ----tga
A0A8C2ZB73_BAX-02      ----tga
                           ***

© 1998-2023Legal notice