Dataset for CDS BAX of Organism Cyclopterus lumpus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C2WGS9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyclopterus lumpus GN=BAX (length=618 residues).
atggccgaccgcggtgaagcggggagagaagacggagaccgggagcctcagggcgccgagggtggggaagatgtaatcga
tgaccccataatggagcagggagcagtggtcctcagagggtacgtggtggcacttgtaaacgcagaggagcccactcgac
acctgtcctctgagcagctgggaggaaggcccaacgaacaacacgaaccacaggtcaaagaggtggtggagcagctgctc
aagatcgcagatgacatcaacaggaatgccgagctccaacgactgatcaaccaggttcagggcaactgtgctcaggagat
ttttatgaaggtggccacgagcatcttcactgagggcatcaactggggtcgagtggtggctctcttccatctggcctaca
gactcatatacaaggcactgaccaccgatcgccttgagaacatccgaataatcatcagctgggttctccaggtcatcaga
gagcaactctacccctggctcgtacagcagggaggctgggtgggggtgatccatgacttttctcggtggaggacggtagc
catcgtggcatcagtagcattggtggcagccctcgtttactacaggaagacacgctga
>gnl|bcl2dbcds|A0A8C2ZB73_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyclopterus lumpus GN=BAX (length=576 residues).
atggcatcacacccgggaggaggcgatgaaggcaataacaaagaccagctactggaactaggagctgttttgttaaaaga
tttcatctacaagcgggttcagcgacatggaggcaatactgaggtgaccaggacccagctgggtggagtagagctgtgtg
accccaaccacaagaagctggcccagtgcctgcagcagattggagacgagttggatggaaatgtagagctgcacaaaatg
ttaaacgactcttcgctcagtcccacaaaagaaatattcatgaaagttagcgttgagatcttttcagatggaaaattcaa
ctggggcagggtggttgcactgttctactttgcctgtcgactcgtcatcaaggctcttgtgacccacattcctgatatca
tcagaacaataatcaactggacgatggactacctccaggaaaatgtgatcaactggatcagggatcaaggtggctgggag
ggtatccgatcccacctgggcacacccacatggcagacggtgggagttttcctggccggtgttctcaccactgttttagt
tattcgcaagatgtga
>gnl|bcl2dbcds|A0A8C2ZB73_BAX-02 BCL2-associated X gene OS=[Eukaryota] Cyclopterus lumpus GN=BAX (length=537 residues).
atggcatcacacccgggaggaggcgatgaaggtaccagctatttcatctacaagcgggttcagcgacatggaggcaatac
tgaggtgaccaggacccagctgggtggagtagagctgtgtgaccccaaccacaagaagctggcccagtgcctgcagcaga
ttggagacgagttggatggaaatgtagagctgcacaaaatgttaaacgactcttcgctcagtcccacaaaagaaatattc
atgaaagttagcgttgagatcttttcagatggaaaattcaactggggcagggtggttgcactgttctactttgcctgtcg
actcgtcatcaaggctcttgtgacccacattcctgatatcatcagaacaataatcaactggacgatggactacctccagg
aaaatgtgatcaactggatcagggatcaaggtggctgggagggtatccgatcccacctgggcacacccacatggcagacg
gtgggagttttcctggccggtgttctcaccactgttttagttattcgcaagatgtga
© 1998-2023Legal notice