Dataset for CDS BCL-2-like of organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W5MLY7_BCL2L10      ---atg--------------tcatgcg-----------------------
A0A4W5KYB3_MCL1-01      ---atg--------------------------------taccacgtt---
A0A4W5LF91_MCL1-01      ---atg--------------------------------taccacgtt---
A0A4W5LZB2_MCL1-01      ---atg--------------------------------aataaca-----
A0A4W5Q5Q2_MCL1-01      ---gca--------------------------------gataaagtc---
A0A4W5Q5Q2_MCL1-02      ---atg--------------------------------gaaacagccaag
A0A4W5QGT1_MCL1-01      ---atgagtctgtcgaagtccattgcacgagccacaactacgatgttgca
A0A4W5LP06_MCL1-01      ---atgagtctgtcg------gttacacgagccacaactacgatgtggca
A0A4W5LP06_MCL1-02      ---atgagtctgtcg------gttacacgagccacaactacgatgtggca
A0A4W5KV00_BCL2-01      ---atg--------------gcaaacg---------acgacaaccgcttt
A0A4W5NW18_BCL2-01      atgatg--------------gcaaacgagaatccttatgacagtcgcttt
A0A4W5JPK5_BCL2L1-      ---atg--------------tcttaca---------gtaacagg---gaa
A0A4W5LYF9_BCL2L1-      ---atg--------------tcttaca---------gtaacagg---gaa
A0A4W5NQ40_BCL2L1-      atgatg--------------acttaca---------acaacaga---gaa
A0A4W5R2W6_BCL2L1-      attatg--------------acttaca---------acaacaga---gaa
A0A4W5R2W6_BCL2L1-      --------------------atgtgta---------ttaacctacctgaa

A0A4W5MLY7_BCL2L10      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LF91_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      cggaaaacgctcctgagtctcttcgacggcacaggcagtatttgcaagcc
A0A4W5QGT1_MCL1-01      ttttcaaaatgga------ggatcttcgtaccttgctaatgatgctagcc
A0A4W5LP06_MCL1-01      ttatcaaaatggagtcttcggaccttcgtactctgc---tggtgctagcc
A0A4W5LP06_MCL1-02      ttatcaaaatggagtcttcggaccttcgtactctgc---tggtgctagcc
A0A4W5KV00_BCL2-01      ata-----------------------------------------------
A0A4W5NW18_BCL2-01      att-----------------------------------------------
A0A4W5JPK5_BCL2L1-      ctg-----------------------------------------------
A0A4W5LYF9_BCL2L1-      ctg-----------------------------------------------
A0A4W5NQ40_BCL2L1-      ctg-----------------------------------------------
A0A4W5R2W6_BCL2L1-      ctg-----------------------------------------------
A0A4W5R2W6_BCL2L1-      ctg-----------------------------------------------

A0A4W5MLY7_BCL2L10      --------------------------------------------------
A0A4W5KYB3_MCL1-01      -----------------------------------ccacatacggttgac
A0A4W5LF91_MCL1-01      -----------------------------------ccacatacggttgac
A0A4W5LZB2_MCL1-01      ------------------------------------cccatggagttg--
A0A4W5Q5Q2_MCL1-01      -----------------------------------------acagttaac
A0A4W5Q5Q2_MCL1-02      cttcgttgaagctggctggaccgtgcgaagactagacatcgacagtcgac
A0A4W5QGT1_MCL1-01      ctttgt----gctatttc---aacgggg---------ctggggcgtcacc
A0A4W5LP06_MCL1-01      ctttgt----gctatttcgcgactggggccgtatgtcctggggcgtcacc
A0A4W5LP06_MCL1-02      ctttgt----gctatttcgcgactggggccgtatgtcctggggcgtcacc
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------

A0A4W5MLY7_BCL2L10      ------------------ggctgtggaaagaaaccctggctatagc----
A0A4W5KYB3_MCL1-01      aaacacaaatgctg-----gacgtgtaagctcgaaatcgacagctt----
A0A4W5LF91_MCL1-01      aaacacaaatgctg-----gacgtgtaagctcgaaatcgacagctt----
A0A4W5LZB2_MCL1-01      ---------------------catgt------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      acggtgctgatatc-----gttgtggacatacgaaagtgggaccct----
A0A4W5QGT1_MCL1-01      gacgtctaaagtg------gacttgggaaatgggactggcgatactccac
A0A4W5LP06_MCL1-01      gaagtcaaaagtggatactgacttgggtaatgggactggcgacactccac
A0A4W5LP06_MCL1-02      gaagtcaaaagtggatactgacttgggtaatgggactggcgacactccac
A0A4W5KV00_BCL2-01      ----------------------gtggaaaagtacatttgtcacaaactct
A0A4W5NW18_BCL2-01      ----------------------gtcgaaaaatacatccatcacaaactgt
A0A4W5JPK5_BCL2L1-      ----------------------gtggtgttttttataagctatagactgt
A0A4W5LYF9_BCL2L1-      ----------------------gtggtgttttttataagctataaactgt
A0A4W5NQ40_BCL2L1-      ----------------------gtggtatactatattacctataaactat
A0A4W5R2W6_BCL2L1-      ----------------------gtggtatactatattacctataaacttt
A0A4W5R2W6_BCL2L1-      ----------------------gtggtatactatattacctataaacttt

A0A4W5MLY7_BCL2L10      ----------------------------------agaggactacctgtct
A0A4W5KYB3_MCL1-01      ----------------------------tgtggagaacgataccct----
A0A4W5LF91_MCL1-01      ----------------------------tgtggagaacgataccct----
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      ----------------------------ttggactctgtcagtgct----
A0A4W5QGT1_MCL1-01      cacgacccacgacgttaggagtgagtgtcgtgaaaagcaacgtcctcgat
A0A4W5LP06_MCL1-01      cacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggt
A0A4W5LP06_MCL1-02      cacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggt
A0A4W5KV00_BCL2-01      ------------------------------tgaaacgaggatatgcgtgg
A0A4W5NW18_BCL2-01      tgaaaatgggatttgtatggaaatttcaagcagaaaacgattatccaaat
A0A4W5JPK5_BCL2L1-      ------------------------------cccagaggaattattcatgt
A0A4W5LYF9_BCL2L1-      ------------------------------cccagagaaattatccatgt
A0A4W5NQ40_BCL2L1-      ------------------------------cacagagggactaccccttc
A0A4W5R2W6_BCL2L1-      ------------------------------cacagagagactaccccttc
A0A4W5R2W6_BCL2L1-      ------------------------------cacagagagactaccccttc

A0A4W5MLY7_BCL2L10      gtctgcagtat---------------------------------------
A0A4W5KYB3_MCL1-01      ----------------------------actgggtgagca----------
A0A4W5LF91_MCL1-01      ----------------------------actgggtgagca----------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      ----------------------------cgagcccgggca----------
A0A4W5Q5Q2_MCL1-02      ----------------------------agagctcggatg----------
A0A4W5QGT1_MCL1-01      aatcatttgtcagaccgaagcaacaatgacgactctgacg----------
A0A4W5LP06_MCL1-01      aatcatttgtcagacctaagcaacaatgacgactctggcg----------
A0A4W5LP06_MCL1-02      aatcatttgtcagacctaagcaacaatgacgactctggcg----------
A0A4W5KV00_BCL2-01      gat---ttcgaggatgctgaggaggaggaaggtgctgctaataatgagtt
A0A4W5NW18_BCL2-01      aatggctttggggacccctctgcac-----cgaacacccg---------c
A0A4W5JPK5_BCL2L1-      tgtcagttggggctggagggtgcaagtggacggactgagg-----gagat
A0A4W5LYF9_BCL2L1-      tgtcaattggtgctggagggtgcaagtggacggactgagg-----gggat
A0A4W5NQ40_BCL2L1-      aaccacattgagctcacggaagcccagaatcggactgagg---------g
A0A4W5R2W6_BCL2L1-      aaccacattgggctcacagaagctcccagtcggactgaggggggtgagag
A0A4W5R2W6_BCL2L1-      aaccacattgggctcacagaagctcccagtcggactgaggggggtgagag

A0A4W5MLY7_BCL2L10      ------------------tatccctgccagtgggtcccgg----------
A0A4W5KYB3_MCL1-01      ------------------catctacc--acgta---------------ta
A0A4W5LF91_MCL1-01      ------------------catctaccacacgca---------------ca
A0A4W5LZB2_MCL1-01      ----------------------------acgca---------------ca
A0A4W5Q5Q2_MCL1-01      ------------------ggtgaca---atgga---------------aa
A0A4W5Q5Q2_MCL1-02      ------------------aataacacccatggagttgcatgtgtatataa
A0A4W5QGT1_MCL1-01      ------------------attctttgccgtgcactccccagatggcgtca
A0A4W5LP06_MCL1-01      ------------------attctttgccatgcactccagagatggcgtca
A0A4W5LP06_MCL1-02      ------------------attctttgccatgcactccagagatggcgtca
A0A4W5KV00_BCL2-01      gatgatttctcctcgcccgggtttggcacggcggtgccacggggccaata
A0A4W5NW18_BCL2-01      ga----------------agtttttgcacggaggtcc-------------
A0A4W5JPK5_BCL2L1-      ga----------------ggccattgcaaatgggtctgtggggaacaaca
A0A4W5LYF9_BCL2L1-      ga----------------agccattgcaaatgggtctttggggaacaaca
A0A4W5NQ40_BCL2L1-      gg----------------gacaggtggaagggggtgcggcagtcatgaca
A0A4W5R2W6_BCL2L1-      gg----------------gacaggtggaagggggggcggcagtcacgaca
A0A4W5R2W6_BCL2L1-      gg----------------gacaggtggaagggggggcggcagtcacgaca

A0A4W5MLY7_BCL2L10      --------------------------------------------------
A0A4W5KYB3_MCL1-01      caacacaggcggacactgcaggtacctcgcggacaggtac----------
A0A4W5LF91_MCL1-01      caa-------------tgaagatatc------------ac----------
A0A4W5LZB2_MCL1-01      caa-------------tgaagatatc------------ac----------
A0A4W5Q5Q2_MCL1-01      cagccaa-gcgg----aaaacatatc------------ac----------
A0A4W5Q5Q2_MCL1-02      gtgccaacgctg----taaagggatc------------ctgagtagttgt
A0A4W5QGT1_MCL1-01      gaatgtgggc------ctgagctatc-----gaattgtcc----------
A0A4W5LP06_MCL1-01      gaatgtgggc------ctgaactatc-----gaattgtcc----------
A0A4W5LP06_MCL1-02      gaatgtgggc------ctgaactatc-----gaattgtcc----------
A0A4W5KV00_BCL2-01      acgcc--------------------------ggaccgggc----------
A0A4W5NW18_BCL2-01      ----------------------------------cagccc----------
A0A4W5JPK5_BCL2L1-      gg------------------------------aacagcag----------
A0A4W5LYF9_BCL2L1-      gg------------------------------aacggcag----------
A0A4W5NQ40_BCL2L1-      tatgt--------------------------caacggcac----------
A0A4W5R2W6_BCL2L1-      caccc--------------------------caacggcac----------
A0A4W5R2W6_BCL2L1-      caccc--------------------------caacggcac----------

A0A4W5MLY7_BCL2L10      -aaag---------------------------------------------
A0A4W5KYB3_MCL1-01      -accaatcgagaagaggagataatgctcatactggggaaggaacggtaca
A0A4W5LF91_MCL1-01      -atca---------------------------------------------
A0A4W5LZB2_MCL1-01      -atca---------------------------------------------
A0A4W5Q5Q2_MCL1-01      -atca---------------------------------------------
A0A4W5Q5Q2_MCL1-02      gagct---------------------------------------------
A0A4W5QGT1_MCL1-01      -atcg---------------------------------------------
A0A4W5LP06_MCL1-01      -atcg---------------------------------------------
A0A4W5LP06_MCL1-02      -atcg---------------------------------------------
A0A4W5KV00_BCL2-01      -agcg---------------------------------------------
A0A4W5NW18_BCL2-01      -accg---------------------------------------------
A0A4W5JPK5_BCL2L1-      -aagc---------------------------------------------
A0A4W5LYF9_BCL2L1-      -aagc---------------------------------------------
A0A4W5NQ40_BCL2L1-      -agtg---------------------------------------------
A0A4W5R2W6_BCL2L1-      -agtg---------------------------------------------
A0A4W5R2W6_BCL2L1-      -agtg---------------------------------------------

A0A4W5MLY7_BCL2L10      --------------------------------------------------
A0A4W5KYB3_MCL1-01      ggaagggaacagtcgcgttccctgaaaccatggaaacctgtgatgctctg
A0A4W5LF91_MCL1-01      -------------------------------ggaaacctgtgatgctctg
A0A4W5LZB2_MCL1-01      -------------------------------ggaaacctgtgatgctctg
A0A4W5Q5Q2_MCL1-01      -------------------------------ggaaacctgtgatgctctg
A0A4W5Q5Q2_MCL1-02      -------------------------------tgaaacctgtgatgctctg
A0A4W5QGT1_MCL1-01      -----------------------------------ggcgatgaagtattg
A0A4W5LP06_MCL1-01      -----------------------------------gccgatgaagtattg
A0A4W5LP06_MCL1-02      -----------------------------------gccgatgaagtattg
A0A4W5KV00_BCL2-01      ---------------------------------t----------------
A0A4W5NW18_BCL2-01      ---------------------------------ccgcgggcgaggacacc
A0A4W5JPK5_BCL2L1-      ---------------------------------aatttggcgaag-----
A0A4W5LYF9_BCL2L1-      ---------------------------------aatttgggtaag-----
A0A4W5NQ40_BCL2L1-      ---------------------------------aacgggacgagtcccgg
A0A4W5R2W6_BCL2L1-      ---------------------------------aacgggacgagtcctgg
A0A4W5R2W6_BCL2L1-      ---------------------------------aacgggacgagtcctgg

A0A4W5MLY7_BCL2L10      --------------------------ccccgccc--------------gg
A0A4W5KYB3_MCL1-01      gacacagacaccaggcaacttatgacatgtgtcctaggacaatatacggg
A0A4W5LF91_MCL1-01      gacacagacaccaggcaacttatgacatgtgtcctaggacaatatacggg
A0A4W5LZB2_MCL1-01      gacacagacaccaggcaacttatgacatgtgtcctaggacaatatacggg
A0A4W5Q5Q2_MCL1-01      gacacagacaccaggcaacttattaaatgtgtcctaggacaatatacggg
A0A4W5Q5Q2_MCL1-02      gacacagacaccaggcaacttattaaatgtgtcctaggacaatatacggg
A0A4W5QGT1_MCL1-01      gaacatgataccagacaactaattgaacattttttgagggactacacagg
A0A4W5LP06_MCL1-01      gaacatgataccagacaagtaattgaagacttattgggggactacacagg
A0A4W5LP06_MCL1-02      gaacatgataccagacaagtaattgaagacttattgggggactacacagg
A0A4W5KV00_BCL2-01      -------------------------tcctcgtct-------ttccaaatg
A0A4W5NW18_BCL2-01      gactc--------------------tccttacca-------aaacaggag
A0A4W5JPK5_BCL2L1-      -------------------------ccctcatct-------ccacagggg
A0A4W5LYF9_BCL2L1-      -------------------------ccttcttct-------cctcagggg
A0A4W5NQ40_BCL2L1-      gactccaccaccacagcagtcgcccccctcctcc-------cctcggcgg
A0A4W5R2W6_BCL2L1-      gactccaccgcga---cagtctcccccctcgtcc-------cctcagcgg
A0A4W5R2W6_BCL2L1-      gactccaccgcga---cagtctcccccctcgtcc-------cctcagcgg

A0A4W5MLY7_BCL2L10      tcctcctcccagcgactcagctgc-------agccatgcggt--------
A0A4W5KYB3_MCL1-01      acttctgaaacgtgggtggaacgaa------agcaaagctctgtcaacaa
A0A4W5LF91_MCL1-01      acttctgaaacgtgggtggaacgaa------agcaaagctctgtcaacaa
A0A4W5LZB2_MCL1-01      acttctgaaacgtgggtggaacgaa------agcaaagctctgtcaacaa
A0A4W5Q5Q2_MCL1-01      acttctgaaacgtgggtggaacgaa------agcaaagctctgtcaacaa
A0A4W5Q5Q2_MCL1-02      acttctgaaacgtgggtggaacgaa------agcaaagctctgtcaacaa
A0A4W5QGT1_MCL1-01      actgtctcagcctcgttggaagcaa------agcaagcctcttacgacga
A0A4W5LP06_MCL1-01      actgtctcaacctcgttggaaggaa------agcaaggctcttacgacga
A0A4W5LP06_MCL1-02      actgtctcaacctcgttggaaggaa------agcaaggctcttacgacga
A0A4W5KV00_BCL2-01      gctctcccaaccggacccacatgcagcaattcacagagtttt--------
A0A4W5NW18_BCL2-01      tc---cgcaacctgacccacatgccaggctcaacagggtcct--------
A0A4W5JPK5_BCL2L1-      -------------ggcatggaggcagtg---aaagcagcact--------
A0A4W5LYF9_BCL2L1-      -------------ggcattgaggcagtg---aaagcagcact--------
A0A4W5NQ40_BCL2L1-      ac---agca----ggcctggacgcagtg---aaagaggcgtt--------
A0A4W5R2W6_BCL2L1-      ac---aatg----ggcctggacgcagtg---aaagaggcatt--------
A0A4W5R2W6_BCL2L1-      ac---aatg----ggcctggacgcagtg---aaagaggcatt--------

A0A4W5MLY7_BCL2L10      ----gccaggcccgggacatggaggccaagcac----cgggcccgcttcc
A0A4W5KYB3_MCL1-01      tgagtagagtcgttggtcaattactggagaaac---acagatacacatac
A0A4W5LF91_MCL1-01      tgagtagagtcgttggtcaattactggagaaac---acagatacacatac
A0A4W5LZB2_MCL1-01      tgagtagagtcgttggtcaattactggagaaac---acagatacacatac
A0A4W5Q5Q2_MCL1-01      tgagtagagtcgttggtcaattactggagaaac---acagatacacatac
A0A4W5Q5Q2_MCL1-02      tgagtagagtcgttggtcaattactggagaaac---acagatacacatac
A0A4W5QGT1_MCL1-01      tgaagcgagtggtggaggacgtaatagcaaagc---accgatacgcattc
A0A4W5LP06_MCL1-01      tgaagcgagtggtgaaggatgtaatagcaaagc---accgatacgcatac
A0A4W5LP06_MCL1-02      tgaagcgagtggtgaaggatgtaatagcaaagc---accgatacgcatac
A0A4W5KV00_BCL2-01      ----gcgtgaggccggggacgaactcgaaagactgtaccagccagacttc
A0A4W5NW18_BCL2-01      ----gcgcgaggcgggtgacgagattggaagaatttatcacccggacttt
A0A4W5JPK5_BCL2L1-      ----acgggactcagtggatgagtttgagctgcgctacacccgtgccttc
A0A4W5LYF9_BCL2L1-      ----acgggactccgttgatgagtttgagctacgctacacccgcgccttc
A0A4W5NQ40_BCL2L1-      ----gcgggactctgccaatgagtttgagctgcgttatgccagagcgttc
A0A4W5R2W6_BCL2L1-      ----gcgggactctgccaatgagtttgagctgcgttatgccagagcgttt
A0A4W5R2W6_BCL2L1-      ----gcgggactctgccaatgagtttgagctgcgttatgccagagcgttt
                                *         *                            *  

A0A4W5MLY7_BCL2L10      ac--gccctagcacacagcttcctgtgccaatgcgggccgaacccctgcg
A0A4W5KYB3_MCL1-01      aatggtatgatcaacacactctacatggatgacagagggg----atgatg
A0A4W5LF91_MCL1-01      aatggtatgatcaacacactctacatggatgacagagggg----atgatg
A0A4W5LZB2_MCL1-01      aatggtatgatcaacacactctacatggatgacagagggg----atgatg
A0A4W5Q5Q2_MCL1-01      aatggtatgatcaacacactctacatgtatgacagagggg----atgatg
A0A4W5Q5Q2_MCL1-02      aatggtatgatcaacacactctacatgtatgacagagggg----atgatg
A0A4W5QGT1_MCL1-01      aatggtatgatcgccaaacttgacttggatgatcgatgcg----atgaca
A0A4W5LP06_MCL1-01      aatggtatgatcgccaaacttgacttagatgaccgatgcg----atgaca
A0A4W5LP06_MCL1-02      aatggtatgatcgccaaacttgacttagatgaccgatgcg----atgaca
A0A4W5KV00_BCL2-01      gcagagatgtcacaccagctgtatctcacatcctccacgg----ctgaga
A0A4W5NW18_BCL2-01      gcagagatgtcggggcagttgcattttacgcccaacacgg----cacaga
A0A4W5JPK5_BCL2L1-      agtgacctctcctcccagctccacatcacccctgccacag----cctacc
A0A4W5LYF9_BCL2L1-      agtgatctctgctcccagctccacatcacccctgccacag----cctacc
A0A4W5NQ40_BCL2L1-      agtgacctgtcctcccagctacacatcacgccgtccacag----cctacc
A0A4W5R2W6_BCL2L1-      agtgacctgtcctcccagctgcacatcacgccggccacag----cctacc
A0A4W5R2W6_BCL2L1-      agtgacctgtcctcccagctgcacatcacgccggccacag----cctacc
                                           *     *             *          

A0A4W5MLY7_BCL2L10      ccagtctgaggagggtgatggaggag---ctggtgggagacggacagatg
A0A4W5KYB3_MCL1-01      tgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtc
A0A4W5LF91_MCL1-01      tgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtc
A0A4W5LZB2_MCL1-01      tgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtc
A0A4W5Q5Q2_MCL1-01      tgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtc
A0A4W5Q5Q2_MCL1-02      tgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtc
A0A4W5QGT1_MCL1-01      tgcgcgtcatcaattctgtggccaagaccatgttcggtgatagggtcacg
A0A4W5LP06_MCL1-01      tgagcttcatcaaatctgtggccaagaccctgttcagtgatgggaccacg
A0A4W5LP06_MCL1-02      tgagcttcatcaaatctgtggccaagaccctgttcagtgatgggaccacg
A0A4W5KV00_BCL2-01      ggagatttagagaggtgatagacgag---ctgttcagggatggg---gtt
A0A4W5NW18_BCL2-01      gaaggtttacggctgtaatagatgag---ctcttcagcgacggg---gta
A0A4W5JPK5_BCL2L1-      acagctttgagagtgtgatggacgaa---gtgttcagggacggg---gtc
A0A4W5LYF9_BCL2L1-      acagctttgagagcgtgatggacgaa---gtgttcagggacggg---gta
A0A4W5NQ40_BCL2L1-      agagctttgagaacgtgatggacgag---gtgttccgggacggt---gtg
A0A4W5R2W6_BCL2L1-      agagcttcgagaacgtgatggatgag---gttttccgtgatggt---gtg
A0A4W5R2W6_BCL2L1-      agagcttcgagaacgtgatggatgag---gttttccgtgatggt---gtg
                           *  *           * *   *     *  *  * **  *       

A0A4W5MLY7_BCL2L10      aactgggggagggtggtctctctgttcaccttcactggtgtgctggttag
A0A4W5KYB3_MCL1-01      aactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtca
A0A4W5LF91_MCL1-01      aactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtca
A0A4W5LZB2_MCL1-01      aactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtca
A0A4W5Q5Q2_MCL1-01      aactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtca
A0A4W5Q5Q2_MCL1-02      aactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtca
A0A4W5QGT1_MCL1-01      aactggggtcgcatcgccagcctggtggcatttggagcagtggtgagcca
A0A4W5LP06_MCL1-01      aactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcca
A0A4W5LP06_MCL1-02      aactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcca
A0A4W5KV00_BCL2-01      aactggggacggattatcgccttcttcgagttcgggggcacaatatgcgt
A0A4W5NW18_BCL2-01      aactggggtcggattgtggctttctttgagtttggagggacaatgtgcgt
A0A4W5JPK5_BCL2L1-      aactggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgt
A0A4W5LYF9_BCL2L1-      aactggggtcgtgtggtgggcctgtttgctttcggcggggccctgtgcgt
A0A4W5NQ40_BCL2L1-      aactggggacgggtggtgggcctgtttgctttcggaggggccctctgtgt
A0A4W5R2W6_BCL2L1-      aactggggacgggtggtgggcctgtttgcctttggaggggccctctgtgt
A0A4W5R2W6_BCL2L1-      aactggggacgggtggtgggcctgtttgcctttggaggggccctctgtgt
                        ********  *  *        *       **    *      *      

A0A4W5MLY7_BCL2L10      agaactacagggggaggacacggaccaggcgctggggaatggcatggggc
A0A4W5KYB3_MCL1-01      gtacttgaaagacgaggggagagacaa----------------------c
A0A4W5LF91_MCL1-01      gtacttgaaagacgaggggagagacaa----------------------c
A0A4W5LZB2_MCL1-01      gtacttgaaagacgaggggagagacaa----------------------c
A0A4W5Q5Q2_MCL1-01      gtacttgaaagacgaggggagagacaa----------------------c
A0A4W5Q5Q2_MCL1-02      gtacttgaaagacgaggggagagacaa----------------------c
A0A4W5QGT1_MCL1-01      gcacctgaaggagaatggcaggggaca----------------------c
A0A4W5LP06_MCL1-01      gcaactgaaggagaggagcaggggaca----------------------c
A0A4W5LP06_MCL1-02      gcaactgaaggagaggagcaggggaca----------------------c
A0A4W5KV00_BCL2-01      ggaatgcgtgaacaaggagatgacctc----------------------g
A0A4W5NW18_BCL2-01      ggagagcgtcaaccgggagatgacgtc----------------------c
A0A4W5JPK5_BCL2L1-      tgagtgtgttgagaaggatatgagccc----------------------a
A0A4W5LYF9_BCL2L1-      tgagtgtgttgagaaggatatgagccc----------------------c
A0A4W5NQ40_BCL2L1-      agaatgtgtggacaaggagatgaaccc----------------------c
A0A4W5R2W6_BCL2L1-      agagtgtgtggagaaggagatgagccc----------------------a
A0A4W5R2W6_BCL2L1-      agagtgtgtggagaaggagatgagccc----------------------a
                          *                *                              

A0A4W5MLY7_BCL2L10      tgggggggaaggagagctgcagggcgctggctgagaccatagcagactac
A0A4W5KYB3_MCL1-01      tgtgtggaggcggtgggagaggag--------------atatcagcatac
A0A4W5LF91_MCL1-01      tgtgtggaggcggtgggagaggag--------------atatcagcatac
A0A4W5LZB2_MCL1-01      tgtgtggaggcggtgggagaggag--------------atatcagcatac
A0A4W5Q5Q2_MCL1-01      tgtgtggagttggtgggagaggag--------------atatcagcatac
A0A4W5Q5Q2_MCL1-02      tgtgtggagttggtgggagaggag--------------atatcagcatac
A0A4W5QGT1_MCL1-01      tgcgttgatttggtgggccaagag--------------attgccacatac
A0A4W5LP06_MCL1-01      tgcattgggttggtgggccaagag--------------atcgccacatac
A0A4W5LP06_MCL1-02      tgcattgggttggtgggccaagag--------------atcgccacatac
A0A4W5KV00_BCL2-01      caagtggatcacatcgcggtgtgg--------------atgacagagtat
A0A4W5NW18_BCL2-01      caggtagacaacatcgcccgttgg--------------atgacggagtac
A0A4W5JPK5_BCL2L1-      ctggtggcgcgcatcgcagactgg--------------atgaccacctac
A0A4W5LYF9_BCL2L1-      ctggtgatgcgcatcgcagactgg--------------atggccacctac
A0A4W5NQ40_BCL2L1-      ttggtgggaaggatcacagactgg--------------atgactgtctac
A0A4W5R2W6_BCL2L1-      ctagtgggacggattgcagactgg--------------atgacagtctac
A0A4W5R2W6_BCL2L1-      ctagtgggacggattgcagactgg--------------atgacagtctac
                                               *              **  *    ** 

A0A4W5MLY7_BCL2L10      ctaggagaggagaagagtgactggatgctggagaacaaaggctgggaggg
A0A4W5KYB3_MCL1-01      ctggtcactcaccacaaggactggctagtcaaacacaactcctggaacgg
A0A4W5LF91_MCL1-01      ctggtcactcaccacaaggactggctagtcaaacacaactcctggaacgg
A0A4W5LZB2_MCL1-01      ctggtcactcaccacaaggactggctagtcaaacacaactcctggaacgg
A0A4W5Q5Q2_MCL1-01      ctggtcactcaccacaaggactggctagtcaaacacaactcctggaacgg
A0A4W5Q5Q2_MCL1-02      ctggtcactcaccacaaggactggctagtcaaacacaactcctggaacgg
A0A4W5QGT1_MCL1-01      ctcctctctgaccaaagggactggctggtcaaaaacaatgcttggaatgg
A0A4W5LP06_MCL1-01      ctcctctctgaccaaagggactggctagtcaaaaacaatgcttggaatgg
A0A4W5LP06_MCL1-02      ctcctctctgaccaaagggactggctagtcaaaaacaatgcttggaatgg
A0A4W5KV00_BCL2-01      ctaaatggaccactgctcaactggattcaggagaacgggggatgggaagc
A0A4W5NW18_BCL2-01      ttgaacggacccctacagaactggatccaggagaatggtggctgggacgc
A0A4W5JPK5_BCL2L1-      ctggacaaccatatccagccctggatccagagccaaggaggatgggaccg
A0A4W5LYF9_BCL2L1-      ctggacaaccatatccagccctggatccagagtcaaggaggatgggaccg
A0A4W5NQ40_BCL2L1-      ctggacaaccacatccagccctggatccagagccaaggaggatgggaccg
A0A4W5R2W6_BCL2L1-      ctggacaaccacatccagccctggatccagagccaaggaggatgggaccg
A0A4W5R2W6_BCL2L1-      ctggacaaccacatccagccctggatccagagccaaggaggatgggaccg
                         *                  **** *        *       *** *   

A0A4W5MLY7_BCL2L10      cttctgtaagttcttccacaca------gcaagagaggtgaac-------
A0A4W5KYB3_MCL1-01      tttcgtggagttcttt------------tcagtagcag-aaacggagtcc
A0A4W5LF91_MCL1-01      tttcgtggagttcttt------------tcagtagcag-aaacggagtcc
A0A4W5LZB2_MCL1-01      tttcgtggagttcttt------------tcagtagcag-aaacggagtcc
A0A4W5Q5Q2_MCL1-01      tttcgtggagttcttt------------tcagtagcag-aaccggagtcc
A0A4W5Q5Q2_MCL1-02      tttcgtggagttcttt------------tcagtagcag-aaccggagtcc
A0A4W5QGT1_MCL1-01      atttgtagagttcttt------------catgtgcaag-atccagagtcc
A0A4W5LP06_MCL1-01      ttttgtagacttcttt------------catgtgcaag-atccagagtcc
A0A4W5LP06_MCL1-02      ttttgtagacttcttt------------catgtgcaag-atccagagtcc
A0A4W5KV00_BCL2-01      ctttgttgagctctatgacaga----------cagagggactcggtgttc
A0A4W5NW18_BCL2-01      ctttgtggagatctatga----------gcagcagaggatctctcactcc
A0A4W5JPK5_BCL2L1-      ttttgcaaagatctttggcagagatgctgctgcagacg-ttcgacggtcc
A0A4W5LYF9_BCL2L1-      ttttgcattgatcttcggcagagatgcagctgcagacg-tccgacggtcc
A0A4W5NQ40_BCL2L1-      gtttgcagagatctttgggatggacgctgcagccgaga-gcaggaagtct
A0A4W5R2W6_BCL2L1-      gtttgcagagatctttgggaaggacgctgcagccgaga-acaggaagtct
A0A4W5R2W6_BCL2L1-      gtttgcagagatctttgggaaggacgctgcagccgaga-acaggaagtct
                         **        ***                                    

A0A4W5MLY7_BCL2L10      ------caggactcgtccatgaagactgccctgtttgctgctg-ctggcg
A0A4W5KYB3_MCL1-01      agatcgaggaacatcatcgcgacccttgtcggattggctggta-ttgggg
A0A4W5LF91_MCL1-01      agatcgaggaacatcatcgcgacccttgtcggattggctggta-ttgggg
A0A4W5LZB2_MCL1-01      agatcgaggaacatcatcgcgacccttgtcggattggctggta-ttgggg
A0A4W5Q5Q2_MCL1-01      agatcgaggaacatcatcgcgacccttgtcggattggctggta-ttgggg
A0A4W5Q5Q2_MCL1-02      agatcgaggaacatcatcgcgacccttgtcggattggctggta-ttgggg
A0A4W5QGT1_MCL1-01      tcagtaaggaacaccctcctagcctttgctggagttgctggga-ttgggg
A0A4W5LP06_MCL1-01      tctgtaaggaacaccctcctagcctttgctggatttgctggga-ttgggg
A0A4W5LP06_MCL1-02      tctgtaaggaacaccctcctagcctttgctggatttgctggga-ttgggg
A0A4W5KV00_BCL2-01      tgttcgtggccgtccatcaagaccgtcttcggcctggctgca--ctgggg
A0A4W5NW18_BCL2-01      ------tggccgtacctaaagacagtgttcggcctggccgcc--ctggga
A0A4W5JPK5_BCL2L1-      ------caggagagcataattaaa----------tggctgctagttgggg
A0A4W5LYF9_BCL2L1-      ------caggagagcttaagaaaa----------tggctgctagttgggg
A0A4W5NQ40_BCL2L1-      ------caggagagctttaagaag----------tggcttctggcgggga
A0A4W5R2W6_BCL2L1-      ------caggagagctttaagaag----------tggttgctggcgggga
A0A4W5R2W6_BCL2L1-      ------caggagagctttaagaag----------tggttgctggcgggga
                                *                         * *         **  

A0A4W5MLY7_BCL2L10      tgggcatcgcagggttaacctt----------------------------
A0A4W5KYB3_MCL1-01      cagcaatgaccttgttagctat----------------------------
A0A4W5LF91_MCL1-01      cagcaatgaccttgttagctat----------------------------
A0A4W5LZB2_MCL1-01      cagcaatgaccttgttagctat----------------------------
A0A4W5Q5Q2_MCL1-01      cagcaatgaccttgttagttat----------------------------
A0A4W5Q5Q2_MCL1-02      cagcaatgaccttgttagttat----------------------------
A0A4W5QGT1_MCL1-01      caacacttgccatgttgatcag----------------------------
A0A4W5LP06_MCL1-01      caacactcgccatgttgatcag----------------------------
A0A4W5LP06_MCL1-02      caacactcgccatgttgatcagatcccaccatccctctctgctgtcctcc
A0A4W5KV00_BCL2-01      --------gccgcaagccttac----------------------------
A0A4W5NW18_BCL2-01      --------gccgccggagtcac----------------------------
A0A4W5JPK5_BCL2L1-      tgattctgctttcaggagtgct----------------------------
A0A4W5LYF9_BCL2L1-      tcatgctgctttcaggagtact----------------------------
A0A4W5NQ40_BCL2L1-      tgacgctggttacaggagtcgt----------------------------
A0A4W5R2W6_BCL2L1-      tgacgctggtcacaggagtcat----------------------------
A0A4W5R2W6_BCL2L1-      tgacgctggtcacaggagtcat----------------------------

A0A4W5MLY7_BCL2L10      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LF91_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-01      ------------------------------------gaa-----------
A0A4W5LP06_MCL1-02      gcagtttttgagctttctccattgataatgaatgaagaacggcggcttat
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------

A0A4W5MLY7_BCL2L10      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LF91_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-01      ------------------ttcag---------cagat-------------
A0A4W5LP06_MCL1-02      ttcatctgaggcacctctttcagatagttttccagatggaaatgcaatat
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------

A0A4W5MLY7_BCL2L10      ----------------------------------cctcctggtccg----
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LF91_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      atagatctgtactcgattctctattctacaaggcaaagggtcttggctgt
A0A4W5KV00_BCL2-01      -------------------------cattggagcataccttacacagaa-
A0A4W5NW18_BCL2-01      -------------------------cattggagccttgttcacccagaa-
A0A4W5JPK5_BCL2L1-      -------------------------ggttggcactctcatcatgaagaaa
A0A4W5LYF9_BCL2L1-      -------------------------ggtcggcactctcatcatgaagaaa
A0A4W5NQ40_BCL2L1-      -------------------------cgtagggtcactctttgctcagaaa
A0A4W5R2W6_BCL2L1-      -------------------------cttagggtcactcattgctcagaaa
A0A4W5R2W6_BCL2L1-      -------------------------cttagggtcactcattgctcagaaa

A0A4W5MLY7_BCL2L10      -----ctaa
A0A4W5KYB3_MCL1-01      -----gtga
A0A4W5LF91_MCL1-01      -----gtga
A0A4W5LZB2_MCL1-01      -----gtga
A0A4W5Q5Q2_MCL1-01      -----gtga
A0A4W5Q5Q2_MCL1-02      -----gtga
A0A4W5QGT1_MCL1-01      -----gtga
A0A4W5LP06_MCL1-01      --tag----
A0A4W5LP06_MCL1-02      tgtaggtga
A0A4W5KV00_BCL2-01      -----gtga
A0A4W5NW18_BCL2-01      -----gtga
A0A4W5JPK5_BCL2L1-      cgccagtga
A0A4W5LYF9_BCL2L1-      tgccagtga
A0A4W5NQ40_BCL2L1-      cgcctgtga
A0A4W5R2W6_BCL2L1-      cgcctgtga
A0A4W5R2W6_BCL2L1-      cgcctgtga

© 1998-2021Legal notice