Dataset for CDS BAK1 of Organism Biomphalaria glabrata

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A182YU00_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=672 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgccagaagctgacataggt
agacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaatct
agattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaactggg
gaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctctca
tttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatggtgg
atggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctgctg
tcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-04 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-05 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-06 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
© 1998-2023Legal notice