Dataset for CDS BAK1 of Organism Biomphalaria glabrata

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A182YU00_BAK1-01      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-02      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-03      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-04      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-05      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-06      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
                        **************************************************

A0A182YU00_BAK1-01      gatgaccttgagagagccacaaatacgccctgattctgaagggaatgtca
A0A182YU00_BAK1-02      gatgaccttgagagagccacaaatacgccctgattctgaagggaatgtca
A0A182YU00_BAK1-03      gatgaccttgagagagccacaaatacgccctgattctgaagggaatgtca
A0A182YU00_BAK1-04      gatgaccttgagagagccacaaatacgccctgattctgaagggaatgtca
A0A182YU00_BAK1-05      gatgaccttgagagagccacaaatacgccctgattctgaagggaatgtca
A0A182YU00_BAK1-06      gatgaccttgagagagccacaaatacgccctgattctgaagggaatgtca
                        **************************************************

A0A182YU00_BAK1-01      gtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaa
A0A182YU00_BAK1-02      gtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaa
A0A182YU00_BAK1-03      gtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaa
A0A182YU00_BAK1-04      gtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaa
A0A182YU00_BAK1-05      gtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaa
A0A182YU00_BAK1-06      gtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaa
                        **************************************************

A0A182YU00_BAK1-01      aatgatctcaacagagaagatgctcaggatattcctgttgttaacgaact
A0A182YU00_BAK1-02      aatgatctcaacagagaagatgctcaggatattcctgttgttaacgaact
A0A182YU00_BAK1-03      aatgatctcaacagagaagatgctcaggatattcctgttgttaacgaact
A0A182YU00_BAK1-04      aatgatctcaacagagaagatgctcaggatattcctgttgttaacgaact
A0A182YU00_BAK1-05      aatgatctcaacagagaagatgctcaggatattcctgttgttaacgaact
A0A182YU00_BAK1-06      aatgatctcaacagagaagatgctcaggatattcctgttgttaacgaact
                        **************************************************

A0A182YU00_BAK1-01      cttgcatctatctgatcctccg---ccagaagctgacataggtagacagt
A0A182YU00_BAK1-02      cttgcatctatctgatcctccgagtccagaagctgacataggtagacagt
A0A182YU00_BAK1-03      cttgcatctatctgatcctccgagtccagaagctgacataggtagacagt
A0A182YU00_BAK1-04      cttgcatctatctgatcctccgagtccagaagctgacataggtagacagt
A0A182YU00_BAK1-05      cttgcatctatctgatcctccgagtccagaagctgacataggtagacagt
A0A182YU00_BAK1-06      cttgcatctatctgatcctccgagtccagaagctgacataggtagacagt
                        **********************   *************************

A0A182YU00_BAK1-01      tggccaggtttggagatagcataaatgccaaatatgctgatgtctttgac
A0A182YU00_BAK1-02      tggccaggtttggagatagcataaatgccaaatatgctgatgtctttgac
A0A182YU00_BAK1-03      tggccaggtttggagatagcataaatgccaaatatgctgatgtctttgac
A0A182YU00_BAK1-04      tggccaggtttggagatagcataaatgccaaatatgctgatgtctttgac
A0A182YU00_BAK1-05      tggccaggtttggagatagcataaatgccaaatatgctgatgtctttgac
A0A182YU00_BAK1-06      tggccaggtttggagatagcataaatgccaaatatgctgatgtctttgac
                        **************************************************

A0A182YU00_BAK1-01      tcaatgatatcaaacctaaatctagattcagataattcagaaaatgctta
A0A182YU00_BAK1-02      tcaatgatatcaaacctaaatctagattcagataattcagaaaatgctta
A0A182YU00_BAK1-03      tcaatgatatcaaacctaaatctagattcagataattcagaaaatgctta
A0A182YU00_BAK1-04      tcaatgatatcaaacctaaatctagattcagataattcagaaaatgctta
A0A182YU00_BAK1-05      tcaatgatatcaaacctaaatctagattcagataattcagaaaatgctta
A0A182YU00_BAK1-06      tcaatgatatcaaacctaaatctagattcagataattcagaaaatgctta
                        **************************************************

A0A182YU00_BAK1-01      tgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
A0A182YU00_BAK1-02      tgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
A0A182YU00_BAK1-03      tgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
A0A182YU00_BAK1-04      tgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
A0A182YU00_BAK1-05      tgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
A0A182YU00_BAK1-06      tgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
                        **************************************************

A0A182YU00_BAK1-01      ggggaaccatcttaattcttctcaactttggatatcgtatagccctcaca
A0A182YU00_BAK1-02      ggggaaccatcttaattcttctcaactttggatatcgtatagccctcaca
A0A182YU00_BAK1-03      ggggaaccatcttaattcttctcaactttggatatcgtatagccctcaca
A0A182YU00_BAK1-04      ggggaaccatcttaattcttctcaactttggatatcgtatagccctcaca
A0A182YU00_BAK1-05      ggggaaccatcttaattcttctcaactttggatatcgtatagccctcaca
A0A182YU00_BAK1-06      ggggaaccatcttaattcttctcaactttggatatcgtatagccctcaca
                        **************************************************

A0A182YU00_BAK1-01      gtcttgaggtcaaagacatcacagtttctctcatttttatcaagaattgt
A0A182YU00_BAK1-02      gtcttgaggtcaaagacatcacagtttctctcatttttatcaagaattgt
A0A182YU00_BAK1-03      gtcttgaggtcaaagacatcacagtttctctcatttttatcaagaattgt
A0A182YU00_BAK1-04      gtcttgaggtcaaagacatcacagtttctctcatttttatcaagaattgt
A0A182YU00_BAK1-05      gtcttgaggtcaaagacatcacagtttctctcatttttatcaagaattgt
A0A182YU00_BAK1-06      gtcttgaggtcaaagacatcacagtttctctcatttttatcaagaattgt
                        **************************************************

A0A182YU00_BAK1-01      ttcttatatatgccgctttattctaagtgagagaatagccaagtggattg
A0A182YU00_BAK1-02      ttcttatatatgccgctttattctaagtgagagaatagccaagtggattg
A0A182YU00_BAK1-03      ttcttatatatgccgctttattctaagtgagagaatagccaagtggattg
A0A182YU00_BAK1-04      ttcttatatatgccgctttattctaagtgagagaatagccaagtggattg
A0A182YU00_BAK1-05      ttcttatatatgccgctttattctaagtgagagaatagccaagtggattg
A0A182YU00_BAK1-06      ttcttatatatgccgctttattctaagtgagagaatagccaagtggattg
                        **************************************************

A0A182YU00_BAK1-01      cggatcatggtggatggagagcagccttgagttacattccactgatgtct
A0A182YU00_BAK1-02      cggatcatggtggatggagagcagccttgagttacattccactgatgtct
A0A182YU00_BAK1-03      cggatcatggtggatggagagcagccttgagttacattccactgatgtct
A0A182YU00_BAK1-04      cggatcatggtggatggagagcagccttgagttacattccactgatgtct
A0A182YU00_BAK1-05      cggatcatggtggatggagagcagccttgagttacattccactgatgtct
A0A182YU00_BAK1-06      cggatcatggtggatggagagcagccttgagttacattccactgatgtct
                        **************************************************

A0A182YU00_BAK1-01      tcaaaaccattctggctagtgactgccctgcaggctgctgctgtcattgg
A0A182YU00_BAK1-02      tcaaaaccattctggctagtgactgccctgcaggctgctgctgtcattgg
A0A182YU00_BAK1-03      tcaaaaccattctggctagtgactgccctgcaggctgctgctgtcattgg
A0A182YU00_BAK1-04      tcaaaaccattctggctagtgactgccctgcaggctgctgctgtcattgg
A0A182YU00_BAK1-05      tcaaaaccattctggctagtgactgccctgcaggctgctgctgtcattgg
A0A182YU00_BAK1-06      tcaaaaccattctggctagtgactgccctgcaggctgctgctgtcattgg
                        **************************************************

A0A182YU00_BAK1-01      catcatcttcagtcacagactatga
A0A182YU00_BAK1-02      catcatcttcagtcacagactatga
A0A182YU00_BAK1-03      catcatcttcagtcacagactatga
A0A182YU00_BAK1-04      catcatcttcagtcacagactatga
A0A182YU00_BAK1-05      catcatcttcagtcacagactatga
A0A182YU00_BAK1-06      catcatcttcagtcacagactatga
                        *************************

© 1998-2023Legal notice