Dataset for CDS BCL-2-like of organism Periophthalmus magnuspinnatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4BFZ8_BCL2L1-      ----atgtctccca---gtaaccgagagctggttgaattct---------
A0A3B3ZMX9_BCL2L1-      ----atgtccctcaacagaga------actggtggaattct---------
A0A3B3ZMX9_BCL2L1-      ----atgtccctcaacagaga------actggtggaattct---------
A0A3B4A3G8_BCL2-01      ----atggcgaacgactgcaatcgcaatattgtggaaaagt---------
A0A3B4AAV4_BCL2L10      ----atgtcgtgtg-------------ggctgtggaaagag---------
A0A3B4AFB7_MCL1-01      ---------------------------------------ga---------
A0A3B4AFB7_MCL1-02      atgaatattattaa-------------ttctccgaagaggaccgcgttaa

A0A3B4BFZ8_BCL2L1-      --------tcataagctac----------------aaattatcacagaaa
A0A3B3ZMX9_BCL2L1-      --------acatccagtac----------------aaactgtctcagcgg
A0A3B3ZMX9_BCL2L1-      --------acatccagtac----------------aaactgtctcagcgg
A0A3B4A3G8_BCL2-01      --------acatttgccat----------------aaactctccaaacgt
A0A3B4AAV4_BCL2L10      --------accttggctct-------------------------------
A0A3B4AFB7_MCL1-01      -------caccacatgcct-------------------------------
A0A3B4AFB7_MCL1-02      aactgtccaccatgggcttgtttctgcctcaaaatggactcgcggagggg

A0A3B4BFZ8_BCL2L1-      aactacccaagttcgctgcttatgtcagaccccgctagggtccag-----
A0A3B3ZMX9_BCL2L1-      gact-gtcctctgcagcacctgggg---------ctgggggacag-----
A0A3B3ZMX9_BCL2L1-      gact-gtcct---------ctgggg---------ctggaggatgg-----
A0A3B4A3G8_BCL2-01      ggcttcgcgtggggttttcacgag--------------gacgcag-----
A0A3B4AAV4_BCL2L10      ggca------gaggactacctgagc---------ctgtgctgcag-----
A0A3B4AFB7_MCL1-01      -aca--------gggtgtgctaact---------ccaccgcttgg-----
A0A3B4AFB7_MCL1-02      gacatgcactgtggggctgcagatt---------cttccgcgcagatgcc
                          *                                         *     

A0A3B4BFZ8_BCL2L1-      -------------------------------tgtgagggcaaca-aggca
A0A3B3ZMX9_BCL2L1-      --------------------------ga---------gcacaca-gagtg
A0A3B3ZMX9_BCL2L1-      --------------------------tacggagattgacacaga-gagag
A0A3B4A3G8_BCL2-01      --------------------aggatgaaggagacgtggccaata---acg
A0A3B4AAV4_BCL2L10      -----------------------------------cggcccaca--ggca
A0A3B4AFB7_MCL1-01      ---------------------------------cacagcccacatttgcg
A0A3B4AFB7_MCL1-02      taggcctgcaactatggacactcgtaaagggaatacggcctcca---gcg

A0A3B4BFZ8_BCL2L1-      gcta----------------atgtcc------------------cgaatg
A0A3B3ZMX9_BCL2L1-      acac-------ggagcatcttggacttggggataggggcgtagacagg-g
A0A3B3ZMX9_BCL2L1-      acag-------ggaccttctgggactgggggacaggagcgtggacaggaa
A0A3B4A3G8_BCL2-01      gttcgatagttgcatcttctccggtt------------------ctggtg
A0A3B4AAV4_BCL2L10      gctc-------c-----tccacctcc------------------cagcgg
A0A3B4AFB7_MCL1-01      gctc-------tcctcatccacgacc------------------ca----
A0A3B4AFB7_MCL1-02      gctc-------tcctcatccacgacc------------------ca----

A0A3B4BFZ8_BCL2L1-      gtatgctaa---------caaaccggaatggcaacagacaaacactggcc
A0A3B3ZMX9_BCL2L1-      ctcggctgcagagagaaacagaggtggacagtacggaactcagacttgac
A0A3B3ZMX9_BCL2L1-      ctccacccc---------ctcacttag----------actcagacttgac
A0A3B4A3G8_BCL2-01      aaccgtcgg-----------------tgccgcgcagagcggctctgttcc
A0A3B4AAV4_BCL2L10      gtcagcctc-----------------tgccatga------g---------
A0A3B4AFB7_MCL1-01      --cagctct-----------------tgtaatgaaaaacga---------
A0A3B4AFB7_MCL1-02      --cagctct-----------------tgtaatgaaaaacga---------

A0A3B4BFZ8_BCL2L1-      tcactgcctcctgatgatcac---------------------------tt
A0A3B3ZMX9_BCL2L1-      tccgcctctgattctgcccccgtccacagccccgcccccttgttggacct
A0A3B3ZMX9_BCL2L1-      tccgcctctgattctgccccc-----------------------------
A0A3B4A3G8_BCL2-01      gctccgtccgaccc---acac-----------------------------
A0A3B4AAV4_BCL2L10      ---gcgcctgggccaggacat-----------------------------
A0A3B4AFB7_MCL1-01      ---acttttaaataagaacac-----------------------------
A0A3B4AFB7_MCL1-02      ---acttttaaataagaacac-----------------------------

A0A3B4BFZ8_BCL2L1-      agacgctattaagactgctctgacggactctgcagatgaatttgaagagt
A0A3B3ZMX9_BCL2L1-      ggacgccgttaaagaggctcttcgtgactccgctaatgagttcgagc-tc
A0A3B3ZMX9_BCL2L1-      ----------------gctcttcgtgactccgctaatgagttcgagc-tc
A0A3B4A3G8_BCL2-01      -gcggccatccacagagtcctgcgcgaggctggagatgaacttgagcggc
A0A3B4AAV4_BCL2L10      -g------------gaggcccagcacaaggca----cgcttcc-----ac
A0A3B4AFB7_MCL1-01      -gcga------gaagaggattacgaaaactcagaggggtctct-----gc
A0A3B4AFB7_MCL1-02      -gcga------gaagaggattacgaaaactcagaggggtctct-----gc
                                        *         *          *            

A0A3B4BFZ8_BCL2L1-      tgttcacaca-agcattcagcaacctttcctctcagc----tcgacatca
A0A3B3ZMX9_BCL2L1-      cgttttagccgcgctttcagcgacctgcaccgccagc----tgcacatca
A0A3B3ZMX9_BCL2L1-      cgttttagccgcgctttcagcgacctgcaccgccagc----tgcacatca
A0A3B4A3G8_BCL2-01      tgtaccagcc-cgacttcaccgagatgtccagacagc----tgtatctga
A0A3B4AAV4_BCL2L10      tctctgagcc-agaccttc-c-------tcaagcagtg---tgggccgga
A0A3B4AFB7_MCL1-01      catgtacgcc-agaattccac-------tcagacagtgaaatggagct--
A0A3B4AFB7_MCL1-02      catgtacgcc-agaattccac-------tcagacagtgaaatggagct--
                          *     *   *   *   *        *   ***     *        

A0A3B4BFZ8_BCL2L1-      cacctgatac-----agcttataacagctttaaaagtgtcatggacgagg
A0A3B3ZMX9_BCL2L1-      cgcccgccac-----agcctatcagagcttcgagagtgtcatggacgaag
A0A3B3ZMX9_BCL2L1-      cgcccgccac-----agcctatcagagcttcgagagtgtcatggacgaag
A0A3B4A3G8_BCL2-01      c-----atcctcaacggcgcagaggaggttcgcggaggttatagacgaac
A0A3B4AAV4_BCL2L10      cccctgctcc--------------agtctccggaag-gtcatggaggagc
A0A3B4AFB7_MCL1-01      ctccagctactcggcggagcacgaagtgttagagagcgacacgaggcagc
A0A3B4AFB7_MCL1-02      ctccagctactcggcggagcacgaagtgttagagagcgacacgaggcagc
                        *        *                  *        *  *      *  

A0A3B4BFZ8_BCL2L1-      tgttcaaagat-------------------ggg--------gttaattgg
A0A3B3ZMX9_BCL2L1-      tgttccgcgat-------------------ggc--------gttaactgg
A0A3B3ZMX9_BCL2L1-      tgttccgcgat-------------------ggc--------gttaactgg
A0A3B4A3G8_BCL2-01      tgttccgcgat-------------------gga--------gtgaactgg
A0A3B4AAV4_BCL2L10      tggtgggagat-------------------gga-----cacttgaactgg
A0A3B4AFB7_MCL1-01      ttcttagcgattttttcaagcttttcacggggatttctcagccgaagtgg
A0A3B4AFB7_MCL1-02      ttcttagcgattttttcaagcttttcacggggatttctcagccgaagtgg
                        *  *    ***                   **            ** ***

A0A3B4BFZ8_BCL2L1-      ggacggattgtgggtctttttgtttttggaggggttttgagtg-------
A0A3B3ZMX9_BCL2L1-      gggcgtgtcgttggcctgtttgccttcgggggcgctctcgctg-------
A0A3B3ZMX9_BCL2L1-      gggcgtgtcgttggcctgtttgccttcgggggcgctctcgctg-------
A0A3B4A3G8_BCL2-01      ggcaggattattgcgtttttcgagtttggtggaaccgtgtgcg-------
A0A3B4AAV4_BCL2L10      ggaagggttgtgtcccttttcacctttgctggggtgctggccagacacat
A0A3B4AFB7_MCL1-01      aaacaacgtccggccctatctacaatgaagggagttgtggacaagctttt
A0A3B4AFB7_MCL1-02      aaacaacgtccggccctatctacaatgaagggagttgtggacaagctttt
                                        * *      *    **     *            

A0A3B4BFZ8_BCL2L1-      tggagtgtgtgg--------------------------agaaggatatga
A0A3B3ZMX9_BCL2L1-      tggagtgtgtgg-----------------------acaaa---gagatga
A0A3B3ZMX9_BCL2L1-      tggagtgtgtgg-----------------------acaaa---gagatga
A0A3B4A3G8_BCL2-01      tggagtgcgcgt-----------------------ccaaagaggacatgt
A0A3B4AAV4_BCL2L10      aaaagagcagaa------------------gagtagcagaccagggctgg
A0A3B4AFB7_MCL1-01      ggaaaagcacagatacgcatataatggtatgataaacaaactggctctgg
A0A3B4AFB7_MCL1-02      ggaaaagcacagatacgcatataatggtatgataaacaaactggctctgg
                           *  *                                    *   ** 

A0A3B4BFZ8_BCL2L1-      gcattctggttcctcgc--------------attgctaactggatgacta
A0A3B3ZMX9_BCL2L1-      gcaccctagtggctcgc--------------atcgtcacctggatgactg
A0A3B3ZMX9_BCL2L1-      gcaccctagtggctcgc--------------atcgtcacctggatgactg
A0A3B4A3G8_BCL2-01      catcccaagtggacaac--------------atcgcagactggatgacgg
A0A3B4AAV4_BCL2L10      accct-----ggacaa------gttcaaggtttgggacaggtgccctcag
A0A3B4AFB7_MCL1-01      acgacaggggggacgacgtatcgttta----ttggcacagtagccaagag
A0A3B4AFB7_MCL1-02      acgacaggggggacgacgtatcgttta----ttggcacagtagccaagag
                                                        * *       *       

A0A3B4BFZ8_BCL2L1-      tctacctggatgagaatatcgccacgtggattca---------------a
A0A3B3ZMX9_BCL2L1-      tgtatctggacgaacacatccaagactggatcga-ctcgc----------
A0A3B3ZMX9_BCL2L1-      tgtatctggacgaacacatccaagactggatcga-ctcgc----------
A0A3B4A3G8_BCL2-01      agtatttgaatggaactctcagcagctggatcca---------------a
A0A3B4AAV4_BCL2L10      ----actgcaggcggctggcacaaactatagctg-attac----------
A0A3B4AFB7_MCL1-01      tatctttgaagatgg-taccactaactggggtcgtattgccagccttata
A0A3B4AFB7_MCL1-02      tatctttgaagatgg-taccactaactggggtcgtattgccagccttata
                              ** *         *      *                       

A0A3B4BFZ8_BCL2L1-      aaccaggga------------------------------ggctggg----
A0A3B3ZMX9_BCL2L1-      ----aaggg------------------------------ggatggg----
A0A3B3ZMX9_BCL2L1-      ----aaggg------------------------------ggatggg----
A0A3B4A3G8_BCL2-01      gacaacggg------------------------------ggatgggaagc
A0A3B4AAV4_BCL2L10      ----ttggg------------------------------ggaagagaaga
A0A3B4AFB7_MCL1-01      gcctttggggctgtggtgtgccagtacctcaagacaaaaggaagagaaag
A0A3B4AFB7_MCL1-02      gcctttggggctgtggtgtgccagtacctcaagacaaaaggaagagaaag
                              **                               **  * *    

A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B4A3G8_BCL2-01      ctttgtgga-----------------------------------------
A0A3B4AAV4_BCL2L10      --------------------------------------------------
A0A3B4AFB7_MCL1-01      ctgtgtggagcgagtgggccaagaaatttcctcatacctcctgttggacc
A0A3B4AFB7_MCL1-02      ctgtgtggagcgagtgggccaagaaatttcctcatacctcctgttggacc

A0A3B4BFZ8_BCL2L1-      ----------ccagctttgctcaaatttttgggcagaatgc---------
A0A3B3ZMX9_BCL2L1-      ----------cccgtttcgcagagatctacgggcaggacgccgcc-----
A0A3B3ZMX9_BCL2L1-      ----------cccgtttcgcagagatctacgggcaggacgccgcc-----
A0A3B4A3G8_BCL2-01      ----------gctgt------acgatcgccaga-gggactcggtcttctc
A0A3B4AAV4_BCL2L10      ---gggactggctgttggaaaacggtggctggg-taggcttctgtgagtt
A0A3B4AFB7_MCL1-01      aacgagactggctagtcaggaataatgcctggg-atggctttgtcgactt
A0A3B4AFB7_MCL1-02      aacgagactggctagtcaggaataatgcctggg-atggctttgtcgactt
                                   *             *     *                  

A0A3B4BFZ8_BCL2L1-      -------------agcaggagaggccagaag------gtcccgagagact
A0A3B3ZMX9_BCL2L1-      -----------------------gcgcagagccgccattccgaagaacgc
A0A3B3ZMX9_BCL2L1-      -----------------------gcgcagagccgccattccgaagaacgc
A0A3B4A3G8_BCL2-01      ct---------------------gctcttggccgtccatcaaaaccgtgt
A0A3B4AAV4_BCL2L10      ctcctgtcatgccaggaaggtggaccaggactcgtcgatgaagaccgctc
A0A3B4AFB7_MCL1-01      ct---------tcagagtagaagacccagagtcagcagtgaggaacacgc
A0A3B4AFB7_MCL1-02      ct---------tcagagtagaagacccagagtcagcagtgaggaacacgc
                                                *             *    *      

A0A3B4BFZ8_BCL2L1-      ctgaagaaatggctgctagttggagtagggttgctagctggag-------
A0A3B3ZMX9_BCL2L1-      ttcaagaaatggctttttgccggaatgaccctggtcaccgggg-------
A0A3B3ZMX9_BCL2L1-      ttcaagaaatggctttttgccggaatgaccctggtcaccgggg-------
A0A3B4A3G8_BCL2-01      tc---ggattagc-tgctatcggagcgg--cgag---cctgac-------
A0A3B4AAV4_BCL2L10      tg------tttgc-tgctgctggggtgggtttag---ctgggcttacctt
A0A3B4AFB7_MCL1-01      tt------atggc-tgtagctgga------ttag---ctgg---------
A0A3B4AFB7_MCL1-02      tt------atggc-tgtagctgga------ttag---ctgg---------
                                 * **        **              *  *         

A0A3B4BFZ8_BCL2L1-      --tgctggt--------tgctatgctcattgctaagaaatag
A0A3B3ZMX9_BCL2L1-      --tcgtggtggggtcactgctcgcccagagac--gcctgtga
A0A3B3ZMX9_BCL2L1-      --tcgtggtggggtcactgctcgcccagagac--gcctgtga
A0A3B4A3G8_BCL2-01      --catcggcg----------cgtacctgtcgc--agaagtga
A0A3B4AAV4_BCL2L10      tctcttggtg-------cgctag-------------------
A0A3B4AFB7_MCL1-01      --tattggtg----caacgctggccatgttga--tcaggtga
A0A3B4AFB7_MCL1-02      --tattggtg----caacgctggccatgttga--tcaggtga

© 1998-2022Legal notice