Dataset for CDS MCL-1 of organism Chelydra serpentina

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C3T6A5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chelydra serpentina GN=MCL-1 (length=996 residues).
atgttggcgttaaagcgcaacgcggtgatcggcctcaacctgtactgcgggggcggcccggcgctggcgccccccccgcc
ggcctccccgagcggcgcgggaacccctcccgcccccggcgcgcgggaccccggcccttcggcggagggcgcccggccgg
cgacgctgattggcggagccgcttgggcttccaacggtcactctgaggggccccgggcgctgattggcgaggcgccccgc
gcgcggagcagctcccccacgaccccccctgcgctggtggccggggggccccggccgggcccgctgtggcggccggaaga
ggagctggacggctgcgaccccgacgccgagaggatgggcccgccggccgctgccgctggcggctccttgcccagcaccc
cgcccgcggacgacgacgacgacctggacgggctgtaccaggactcgctggagctcatcagccgctacctgcgggaggcc
gcggagctcgccgggcccggcggcaagaagctctacaagcggctgctgagcgggccgcggggggcgggccccgccgccat
ggagaaggcgctggagacgctgcggagggtcggcgacggcgtcattgaaaagcaccagatcgccttccaagggatgcttc
ggaaactagacatcaagaataaggaggatctgaagtcagtgactgctgttgcaacccatgttttcagtgatggagtaaca
aactggggtagaattgtgacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagacttg
catcaacacactagcagggatcatcacagatgtgcttgtcacagacaaacgagattggctagttaaccaaagaggctggg
agggatttgttgaattcttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgcaggctttgct
ggactgggagcaagtttggcctacatgatgcgatga
>gnl|bcl2dbcds|A0A8C3TAL3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chelydra serpentina GN=MCL-1 (length=579 residues).
atgttggcgttaaagcggaacgtggtgatcagcctcaacctgtactgtgggggcggcccatcgctggcgccctccccgaa
cggcgtgggaacccctcccgccccccggctgctgagtgggccacggggggcaggccccgccgccatggaaacggcgctgg
agatgctgcggagggtcggcaacggcgtcattgagaagcaccagatcgccttccaagggatggttcggaagctagacatc
aagaatgaggaggatctgaagtcagtgacggctgttgcaacccatgttttcagtgatggagtagcatggggtagaattgt
gacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagacttgcatcaacacactagcag
ggattatcacagatgtgattgtcccaggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattc
ttccgtggagaggatctagaaggtagcatcaggaacgttctggtggcttttgcaggctttgctggactggaagcaagttt
ggcctgcatgatgcaatga
© 1998-2022Legal notice