Dataset for CDS MCL-1 of organism Chelydra serpentina

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3T6A5_MCL1-01      atgttggcgttaaagcgcaacgcggtgatcggcctcaacctgtactgcgg
A0A8C3TAL3_MCL1-01      atgttggcgttaaagcggaacgtggtgatcagcctcaacctgtactgtgg
                        ***************** **** ******* **************** **

A0A8C3T6A5_MCL1-01      gggcggcccggcgctggcgccccccccgccggcctccccgagcggcgcgg
A0A8C3TAL3_MCL1-01      gggcggcccatcgctggcgc------------cctccccgaacggcgtgg
                        *********  *********            ********* ***** **

A0A8C3T6A5_MCL1-01      gaacccctcccgcccccggcgcgcgggaccccggcccttcggcggagggc
A0A8C3TAL3_MCL1-01      gaacccctcccgccccc---------------------------------
                        *****************                                 

A0A8C3T6A5_MCL1-01      gcccggccggcgacgctgattggcggagccgcttgggcttccaacggtca
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3T6A5_MCL1-01      ctctgaggggccccgggcgctgattggcgaggcgccccgcgcgcggagca
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3T6A5_MCL1-01      gctcccccacgaccccccctgcgctggtggccggggggccccggccgggc
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3T6A5_MCL1-01      ccgctgtggcggccggaagaggagctggacggctgcgaccccgacgccga
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3T6A5_MCL1-01      gaggatgggcccgccggccgctgccgctggcggctccttgcccagcaccc
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3T6A5_MCL1-01      cgcccgcggacgacgacgacgacctggacgggctgtaccaggactcgctg
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3T6A5_MCL1-01      gagctcatcagccgctacctgcgggaggccgcggagctcgccgggcccgg
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3T6A5_MCL1-01      cggcaagaagctctacaagcggctgctgagcgggccgcggggggcgggcc
A0A8C3TAL3_MCL1-01      -------------------cggctgctgagtgggccacggggggcaggcc
                                           *********** ***** ******** ****

A0A8C3T6A5_MCL1-01      ccgccgccatggagaaggcgctggagacgctgcggagggtcggcgacggc
A0A8C3TAL3_MCL1-01      ccgccgccatggaaacggcgctggagatgctgcggagggtcggcaacggc
                        ************* * *********** **************** *****

A0A8C3T6A5_MCL1-01      gtcattgaaaagcaccagatcgccttccaagggatgcttcggaaactaga
A0A8C3TAL3_MCL1-01      gtcattgagaagcaccagatcgccttccaagggatggttcggaagctaga
                        ******** *************************** ******* *****

A0A8C3T6A5_MCL1-01      catcaagaataaggaggatctgaagtcagtgactgctgttgcaacccatg
A0A8C3TAL3_MCL1-01      catcaagaatgaggaggatctgaagtcagtgacggctgttgcaacccatg
                        ********** ********************** ****************

A0A8C3T6A5_MCL1-01      ttttcagtgatggagtaacaaactggggtagaattgtgacactcatctct
A0A8C3TAL3_MCL1-01      ttttcagtgatggagtagca---tggggtagaattgtgacactcatctct
                        ***************** **   ***************************

A0A8C3T6A5_MCL1-01      tttggtgcctttgttgcaaaacacctgaagagcataaaccaggagacttg
A0A8C3TAL3_MCL1-01      tttggtgcctttgttgcaaaacacctgaagagcataaaccaggagacttg
                        **************************************************

A0A8C3T6A5_MCL1-01      catcaacacactagcagggatcatcacagatgtgcttgtcacagacaaac
A0A8C3TAL3_MCL1-01      catcaacacactagcagggattatcacagatgtgattgtcccaggcaaac
                        ********************* ************ ***** *** *****

A0A8C3T6A5_MCL1-01      gagattggctagttaaccaaagaggctgggagggatttgttgaattcttc
A0A8C3TAL3_MCL1-01      gagattggctagttaaccaaagaggctgggagggatttgttgaattcttc
                        **************************************************

A0A8C3T6A5_MCL1-01      cgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgc
A0A8C3TAL3_MCL1-01      cgtggagaggatctagaaggtagcatcaggaacgttctggtggcttttgc
                        **** *************************** *****************

A0A8C3T6A5_MCL1-01      aggctttgctggactgggagcaagtttggcctacatgatgcgatga
A0A8C3TAL3_MCL1-01      aggctttgctggactggaagcaagtttggcctgcatgatgcaatga
                        ***************** ************** ******** ****

© 1998-2022Legal notice