Dataset for CDS Unclassified of organism Capitella teleta

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|R7T3X7_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Capitella teleta (length=1164 residues).
atggatagagatgacaaaacaaggcttcgggctaacttgactactttaaggactattccagttggcgagatttcagaccg
tctttgggtagagggtgttttggacgacgacgatttagactcgtttaaggtgaataaggcaccccgagagatatccagcg
atttgtttaagacaatcatacgcaagggacaggagaatcactatgccatcctgtgtactgttttgaaagacgagggttat
gagcatgtcgtgcagcagctgaacgcaacggatttaacgcaatataattataattttgatgcctcaccccagaagaagat
gcaggcgctgtgtgagcaattggcgaatatgcaacaagacatctatgcagagaatgaatatttgaaaagcaagttgggaa
cgattaatcgtgaattgaaatcagtggaagaacgggaggccaggctgcgggaatccaaagcggaaatggacccgaacatc
gtggcgtacatcaatgagcgcatcacggggcgcgcccttcccagtgatagcgtggatgccgctggtgtgggcagcctggg
aagttcgtttattcctccctacattcaagagtggatgaacctccgaaaacccgtgatgaatgccaacgcaacggagcaga
ttgctcggcagttgggagcggacattgtgtcgtacaagtgcatgagtgaccctccccctgccatcaccacgtacgccacc
aggatgcgtgcgatcgtagacgaaattctcgtccgatacgaggagtcatttgtgaagttcatggacgttctgtacttgga
cgagatcaatggtttgcaaacgctgtggaatgtggcagaccaggtgtttgcagacttcaaagagggtgaaaaccccaact
ggggccacgtgtgcaccctgtacgcctttggcgcttatgtcgctaagcacagtttcaacggtgaggcagatccgcaaatg
gccaactttgttggcgatttcctcggatattacgtgtcaaagaaacttggtgcgaccatcgtgaagactggcggctggaa
tgccttccttcagcactttgatcgcactgcttctcctgatggtcgtagtatgatgctcattttcatgtcgcttgctgttt
gggtctcaaccatcatcttctcacttcctggaaatgagttctaa
>gnl|bcl2dbcds|R7TIZ4_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Capitella teleta (length=663 residues).
atggctcctccctctgcggctgatcctcttgatcggcctcaggccatgcctcaggaggcttgttctgaccctcagaggca
gccccaacagcagtttgtgctcactggagacttcctccccagtggcttccgcgttcagtctctgcaagtggctcaggatg
ccattcactacatctgccagcatgagagctgcgcccctccccccaaccgcactgctctgatcatgcgcaacctcctcgat
gacactcttaaacatcgactggatatgatgcgcaacctggtgatgaccctggacatagaggaacgcaaccagttagagct
gctgcataatatcgcaaccagtatgtttgatgaccagcttgtcaactggggtcgcatcgtcaccttccatgcgttttgcg
gatacctggcgaggtattgtgaggagaggcagattcctgactgcggagatctgattgcggacattctgtccagcactgtc
attaaccgtttggggctgtggatcgttgccaatggtggatggaatgcttttgagcagcagttccctccatcttgtctgtg
ggaaacgaaaggcgtttggaaaggcatcgcgatcattgctttgcttattggtgccattcttgcgttctactcatcgatga
ggtttatgaactcatccagctga
© 1998-2022Legal notice