Dataset for CDS BCL-2-like of organism Gallus gallus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=1248 residues).
atgggggtcggccccgcgtccggcagcggagcgaagcggcccttgtggccctttttcacccccaaattccacttctcccc
cccgaggacaccccgagcgcggcacgaccgctccccgctcccctccccccgcgggggccgcaccggaagcggaaccgccc
ccccatggcgtcaccgcggccatataacagtcccggctttacccgcccgcgccacccgccgccggtgctcgctgggcgcc
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccgaaagtggaggagttga
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=1119 residues).
atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctggtgcccgcttc
accagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgaggtaccgcggc
cgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctccggggcggcc
ccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagccc
cgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggcggcgggagag
gccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagcagcgccgtcat
ggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccagggaatgcttc
ggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatggagtaaca
aactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
catcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccagggaggctggg
agggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtggcc
ggcctgggggcgagcttggcctacatgatccgcccaggaccccacccgcggcctccggggatggggcacccacagaacga
ggcagcagtgacagcagctcggggcctccaggtaaggaacttcttcctcacaggcgacctcaataaatggctgttttaa
>gnl|bcl2dbcds|A0A1L1RNM6_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gallus gallus GN=MCL-1 (length=1326 residues).
atgcacggagtccaacagggaactcatcaccgctttcttgagcgcctccgtggacggactccgccgcagctcccggccct
cagccggcggatgggggtcggccccgcgtccggcagcggagcgaagcggcccttgtggccctttttcacccccaaattcc
acttctcccccccgaggacaccccgagcgcggcacgaccgctccccgctcccctccccccgcgggggccgcaccggaagc
ggaaccgcccccccatggcgtcaccgcggccatataacagtcccggctttacccgcccgcgccacccgccgccggtgctc
gctgggcgccatgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaagcccgggcctgg
tgcccgcttcaccagcaggagagcaaaccccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgag
gtaccgcggccgctgattggctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgctcccattggctc
cggggcggccccccacgctccgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcggcccgtcgctc
tgtggagccccgaggaggagttggacggctgcgagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacg
ccgcccgagctgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatcctccggtacctccgggaggc
ggcgggagaggccgagcccggcgttaaaaagctgtttccggggctcctgggagggccagggcggcccggcagggcgagca
gcgccgtcatggagaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaattggccttccag
ggaatgcttcggaagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatga
tggagtaacaaactggggccgagttgtcacgctcatctcatttggtgcctttgttgcaaaacacctgaaaagcatcaacc
aagagaaatgcatcacctcgctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggctgatgagccag
ggaggctgggagggctttgttgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgc
aggagtggccggcctgggggcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|Q00709_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gallus gallus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccgcccgtgcccccggccccggctcccgctgctgctcccgctgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
cgccccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggacttcgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtg
atggggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacgg
aggatgggatgcctttgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|Q07816_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gallus gallus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagagggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagctgaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccccctgccggccacgtagtgaacggagccaccgtgcaccggagcagcctggaagttcatgaaattgttcgagcatcc
gacgtgaggcaggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggatctgtatgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctcaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|Q9W6F2_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Gallus gallus GN=BCL2A1 (length=483 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcagtatgtgcttcaggaatcacatctcgg
accagcccaaaccagagttgctcatgtcttgcgaaacattgcatcttcactccaagatcagacagaggaggctctcagac
ccttcttggacaggatcgatattacctccgtagatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcacgg
agttcagctcactggagaggagaaggagaagatttcttatttcatcacagagtacatcataaataacaaagccgcatgga
tagatgcaaacggtggctgggtaagtttcaatttggtgtcttctcattttccagcacagcgtagattcaaacatttgtct
taa
© 1998-2022Legal notice