Dataset for CDS BCL-2-like of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q9W6F2_BCL2A1-01        atg-----------------------------------------------
Q07816_BCL2L1-03        atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagct
Q07816_BCL2L1-02        atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagct
Q07816_BCL2L1-01        atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagct
Q07816_BCL2L1-04        atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagct
Q00709_BCL2-01          atg-----------------------------------------------
A0A1L1RNM6_MCL1-01      atgtttgcagtcaagcggaacgccgtcatcggcttcaacctcta----ct
A0A1L1RNM6_MCL1-02      atgtttgcagtcaagcggaacgccgtcatcggcttcaacctcta----ct

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-03        ctcacagagggggcactg--ctggagcgagct-----ggaggaagag---
Q07816_BCL2L1-02        ctcacagagggggcactg--ctggagcgagct-----ggaggaagag---
Q07816_BCL2L1-01        ctcacagagggggcactg--ctggagcgagct-----ggaggaagag---
Q07816_BCL2L1-04        ctcacagagggggcactg--ctggagcgagct-----ggaggaagag---
Q00709_BCL2-01          -------------------------gctcacc---ccgggagaagag---
A0A1L1RNM6_MCL1-01      gcggcggaggaagcccgggcctggtgcccgcttcaccagcaggagagcaa
A0A1L1RNM6_MCL1-02      gcggcggaggaagcccgggcctggtgcccgcttcaccagcaggagagcaa

Q9W6F2_BCL2A1-01        ---------------------------------------gaaact---gc
Q07816_BCL2L1-03        -----------------------gatgagaacag-gactgacactgcagc
Q07816_BCL2L1-02        -----------------------gatgagaacag-gactgacactgcagc
Q07816_BCL2L1-01        -----------------------gatgagaacag-gactgacactgcagc
Q07816_BCL2L1-04        -----------------------gatgagaacag-gactgacactgcagc
Q00709_BCL2-01          ---------------------gctacgacaaccg----cgagatagt-gc
A0A1L1RNM6_MCL1-01      accccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgc
A0A1L1RNM6_MCL1-02      accccgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgc
                                                               *  *     **

Q9W6F2_BCL2A1-01        tgagttctat----------------------------------------
Q07816_BCL2L1-03        tgag------------------------gcagagatg-gacagcgtcctc
Q07816_BCL2L1-02        tgag------------------------gcagagatg-gacagcgtcctc
Q07816_BCL2L1-01        tgag------------------------gcagagatg-gacagcgtcctc
Q07816_BCL2L1-04        tgag------------------------gcagagatg-gacagcgtcctc
Q00709_BCL2-01          tgaagtacatccactataaactctcgcagcggggctacgactgggccgcc
A0A1L1RNM6_MCL1-01      tgaggtaccgcggccgctgattggctccgcggggctg----tgggccgcc
A0A1L1RNM6_MCL1-02      tgaggtaccgcggccgctgattggctccgcggggctg----tgggccgcc

Q9W6F2_BCL2A1-01        -------------------tacgtttattatttagctcaag---------
Q07816_BCL2L1-03        aatgggagc-------ccatcctggcacccccctg--ccgg---------
Q07816_BCL2L1-02        aatgggagc-------ccatcctggcacccccctg--ccgg---------
Q07816_BCL2L1-01        aatgggagc-------ccatcctggcacccccctg--ccgg---------
Q07816_BCL2L1-04        aatgggagc-------ccatcctggcacccccctg--ccgg---------
Q00709_BCL2-01          ggcgaggac----aggccgcccgtgccccc---ggccccgg--------c
A0A1L1RNM6_MCL1-01      gccggccgcgccgaagccccccgcgctcccattggctccggggcggcccc
A0A1L1RNM6_MCL1-02      gccggccgcgccgaagccccccgcgctcccattggctccggggcggcccc
                                             *            *  *  *         

Q9W6F2_BCL2A1-01        ---------------attatctgcag-----tatgtgcttcagga-----
Q07816_BCL2L1-03        ccacgtagtgaacggagccaccgtg-------------caccgga-----
Q07816_BCL2L1-02        ccacgtagtgaacggagccaccgtg-------------caccgga-----
Q07816_BCL2L1-01        ccacgtagtgaacggagccaccgtg-------------caccgga-----
Q07816_BCL2L1-04        ccacgtagtgaacggagccaccgtg-------------caccgga-----
Q00709_BCL2-01          tcccgctgc---tgctcccgctgcgg-----tggctgctgctgga-----
A0A1L1RNM6_MCL1-01      ccacgctccgatcggttccgccgcggcccgccgggcgccgccggactcca
A0A1L1RNM6_MCL1-02      ccacgctccgatcggttccgccgcggcccgccgggcgccgccggactcca
                                            * *                 * ***     

Q9W6F2_BCL2A1-01        -----------atcacatctcggaccagcccaaa----------------
Q07816_BCL2L1-03        --------------gcagcctggaagttcatgaaattgttcga-------
Q07816_BCL2L1-02        --------------gcagcctggaagttcatgaaattgttcga-------
Q07816_BCL2L1-01        --------------gcagcctggaagttcatgaaattgttcga-------
Q07816_BCL2L1-04        --------------gcagcctggaagttcatgaaattgttcga-------
Q00709_BCL2-01          -gcctcctcccaccaccgccccgagccccccg-----gctcggctgctgc
A0A1L1RNM6_MCL1-01      cgtcgcggcccgtcgctctgtggagccccgaggaggagttggacggctgc
A0A1L1RNM6_MCL1-02      cgtcgcggcccgtcgctctgtggagccccgaggaggagttggacggctgc
                                       *      **    *                     

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-03        ------------------------------------------------gc
Q07816_BCL2L1-02        ------------------------------------------------gc
Q07816_BCL2L1-01        ------------------------------------------------gc
Q07816_BCL2L1-04        ------------------------------------------------gc
Q00709_BCL2-01          tagt---------gaggtgcccccggctgaggggctgcgccc--cgcgcc
A0A1L1RNM6_MCL1-01      gagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgcc
A0A1L1RNM6_MCL1-02      gagcccgagtccgaacgcggccccggaggcgattcgttgcccggcacgcc

Q9W6F2_BCL2A1-01        -ccagagttgct---catgtcttgcgaaacatt----------------g
Q07816_BCL2L1-03        atccga--cgtgaggcaggcgctgagagatgcgggggat----------g
Q07816_BCL2L1-02        atccga--cgtgaggcaggcgctgagagatgcgggggat----------g
Q07816_BCL2L1-01        atccga--cgtgaggcaggcgctgagagatgcgggggat----------g
Q07816_BCL2L1-04        atccga--cgtgaggcaggcgctgagagatgcgggggat----------g
Q00709_BCL2-01          tcccgg--cgtccacctcgccctgcgccaggccggggac----------g
A0A1L1RNM6_MCL1-01      gcccgagctgcccgacttgatccccgacgagctgcggcaggaatccctgg
A0A1L1RNM6_MCL1-02      gcccgagctgcccgacttgatccccgacgagctgcggcaggaatccctgg
                          * *    *     *  *      *                       *

Q9W6F2_BCL2A1-01        catcttcactccaagatcagacagaggaggc-------------------
Q07816_BCL2L1-03        agtttgagctgaggtaccggagggctt-----tcagcgacctcacctccc
Q07816_BCL2L1-02        agtttgagctgaggtaccggagggctt-----tcagcgacctcacctccc
Q07816_BCL2L1-01        agtttgagctgaggtaccggagggctt-----tcagcgacctcacctccc
Q07816_BCL2L1-04        agtttgagct----------------------------------------
Q00709_BCL2-01          agttctcgcgccgctaccagagggacttcgc-ccagatgtcgggcc----
A0A1L1RNM6_MCL1-01      agctcatcctccggtacctccgggaggcggcgggagaggccgagcccggc
A0A1L1RNM6_MCL1-02      agctcatcctccggtacctccgggaggcggcgggagaggccgagcccggc

Q9W6F2_BCL2A1-01        ------------tctcagacccttcttgga-----------------cag
Q07816_BCL2L1-03        agctccacatcacccctgg----------------------------cac
Q07816_BCL2L1-02        agctccacatcacccctgg----------------------------cac
Q07816_BCL2L1-01        agctccacatcacccctgg----------------------------cac
Q07816_BCL2L1-04        --------------------------------------------------
Q00709_BCL2-01          -------agctgcacctgacgccctt---------------------cac
A0A1L1RNM6_MCL1-01      gttaaaaagctgtttccggggctcctgggagggccagggcggcccggcag
A0A1L1RNM6_MCL1-02      gttaaaaagctgtttccggggctcctgggagggccagggcggcccggcag

Q9W6F2_BCL2A1-01        gatcgatattacctccgtaga------------tgttgccaagagaattt
Q07816_BCL2L1-03        ggcgtaccagagctttgagca-----------------------------
Q07816_BCL2L1-02        ggcgtaccagagctttgagca-----------------------------
Q07816_BCL2L1-01        ggcgtaccagagctttgagca-----------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q00709_BCL2-01          ggcccacggccgcttcgtggc-----------------------------
A0A1L1RNM6_MCL1-01      ggcgagcagcgccgtcatggagaaagcgctggaaacgttgcggagggtcg
A0A1L1RNM6_MCL1-02      ggcgagcagcgccgtcatggagaaagcgctggaaacgttgcggagggtcg

Q9W6F2_BCL2A1-01        tcaatggagtcatggaagaaa-----------------------------
Q07816_BCL2L1-03        -------ggtagtgaatgaac-----------------------------
Q07816_BCL2L1-02        -------ggtagtgaatgaac-----------------------------
Q07816_BCL2L1-01        -------ggtagtgaatgaac-----------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q00709_BCL2-01          -------cgtggtggaggagc-----------------------------
A0A1L1RNM6_MCL1-01      gggacggcgtgatgcagaaacacgaattggccttccagggaatgcttcgg
A0A1L1RNM6_MCL1-02      gggacggcgtgatgcagaaacacgaattggccttccagggaatgcttcgg

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      aagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggc
A0A1L1RNM6_MCL1-02      aagctggaaatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggc

Q9W6F2_BCL2A1-01        --------aatttgctgatggaaatactaactggggacgaattatgacca
Q07816_BCL2L1-03        --------tcttccatgatggtgt---gaactgggggcgcatcgtggctt
Q07816_BCL2L1-02        --------tcttccatgatggtgt---gaactgggggcgcatcgtggctt
Q07816_BCL2L1-01        --------tcttccatgatggtgt---gaactgggggcgcatcgtggctt
Q07816_BCL2L1-04        --------------------------------------------------
Q00709_BCL2-01          --------tcttccgtgatggggt---caactggggccggatcgtcgcct
A0A1L1RNM6_MCL1-01      tgctcacgttttcaatgatggagtaacaaactggggccgagttgtcacgc
A0A1L1RNM6_MCL1-02      tgctcacgttttcaatgatggagtaacaaactggggccgagttgtcacgc

Q9W6F2_BCL2A1-01        tatttacttttggaggtcttctcaccaagaagcttcaagagcacggagtt
Q07816_BCL2L1-03        tcttctccttcggaggg------gctttg-tgcgtggagagcgtgga---
Q07816_BCL2L1-02        tcttctccttcggaggg------gctttg-tgcgtggagagcgtgga---
Q07816_BCL2L1-01        tcttctccttcggaggg------gctttg-tgcgtggagagcgtgga---
Q07816_BCL2L1-04        ------------gaggg------gctttg-tgcgtggagagcgtgga---
Q00709_BCL2-01          tcttcgagttcggcggc------gtgatg-tgcgtcgagagcgtcaa---
A0A1L1RNM6_MCL1-01      tcatctcatttggtgcctttgttgcaaaa-cacctgaaaagcatcaa---
A0A1L1RNM6_MCL1-02      tcatctcatttggtgcctttgttgcaaaa-cacctgaaaagcatcaa---
                                    * *                 * *  * ***    *   

Q9W6F2_BCL2A1-01        cagctcactggagagga-------------gaaggagaagatttcttatt
Q07816_BCL2L1-03        ------caaggagatgc------gggtactggtgggacgcattgtgtctt
Q07816_BCL2L1-02        ------caaggagatgc------gggtactggtgggacgcattgtgtctt
Q07816_BCL2L1-01        ------caaggagatgc------gggtactggtgggacgcattgtgtctt
Q07816_BCL2L1-04        ------caaggagatgc------gggtactggtgggacgcattgtgtctt
Q00709_BCL2-01          ------ccgggagatgt------cgccgctggtggacaacattgccacct
A0A1L1RNM6_MCL1-01      ------ccaagagaaatgcatcacctcgctggcggggatcatcac-----
A0A1L1RNM6_MCL1-02      ------ccaagagaaatgcatcacctcgctggcggggatcatcac-----
                                  ****                *  **     **        

Q9W6F2_BCL2A1-01        tcatcacagagtacatcataaataacaaagccgcatggatagatgcaaac
Q07816_BCL2L1-03        ggatgaccacgtacttgaccgaccatctagatccctggatccaggagaat
Q07816_BCL2L1-02        ggatgaccacgtacttgaccgaccatctagatccctggatccaggagaat
Q07816_BCL2L1-01        ggatgaccacgtacttgaccgaccatctagatccctggatccaggagaat
Q07816_BCL2L1-04        ggatgaccacgtacttgaccgaccatctagatccctggatccaggagaat
Q00709_BCL2-01          ggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaac
A0A1L1RNM6_MCL1-01      ggacgcattggt--ctcatccaa-----acgcgagtggctgatgagccag
A0A1L1RNM6_MCL1-02      ggacgcattggt--ctcatccaa-----acgcgagtggctgatgagccag
                          *       **   * *                 *** *        * 

Q9W6F2_BCL2A1-01        ggtggctgggaaaac-----ggtttccta----------------acgaa
Q07816_BCL2L1-03        ggcggctgggagcgctttgtggatctgtatgggaacaacgctgctgccga
Q07816_BCL2L1-02        ggcggctgggagcgctttgtggatctgtatgggaacaacgctgctgccga
Q07816_BCL2L1-01        ggcggctgggagcgctttgtggatctgtatgggaacaacgctgctgccga
Q07816_BCL2L1-04        ggcggctgggagcgctttgtggatctgtatgggaacaacgctgctgccga
Q00709_BCL2-01          ggaggatgggatgcctttgtggaattgta-----------------c---
A0A1L1RNM6_MCL1-01      ggaggctgggagggctttgttgacttctt-----------------ccga
A0A1L1RNM6_MCL1-02      ggaggctgggagggctttgttgacttctt-----------------ccga
                        ** ** *****   *      *     *                  *   

Q9W6F2_BCL2A1-01        gtt---------tgaaagaagatcacccctat----------ctttctct
Q07816_BCL2L1-03        gctga-------ggaagggccaggagaccttcaacaaatggctcctcacc
Q07816_BCL2L1-02        gctga-------ggaagggccaggagaccttcaacaaatggctcctcacc
Q07816_BCL2L1-01        gctga-------ggaagggccaggagaccttcaacaaatggctcctcacc
Q07816_BCL2L1-04        gctga-------ggaagggccaggagaccttcaacaaatggctcctcacc
Q00709_BCL2-01          ------------ggcaacagtatgaggccttt-gtt--cgatttctc-ct
A0A1L1RNM6_MCL1-01      gttgaggacctggaaagcagcatcaggaatgt-gctgatggcctttg-ca
A0A1L1RNM6_MCL1-02      gttgaggacctggaaagcagcatcaggaatgt-gctgatggcctttg-ca
                                       *     *  *    *               *  * 

Q9W6F2_BCL2A1-01        aca----attacagacatatttgcagctgtt-----------ctttcctt
Q07816_BCL2L1-03        ggg-------------------gcgaccgtggccggagtgcttctg----
Q07816_BCL2L1-02        ggg-------------------gcgaccgtggccggagtgcttctg----
Q07816_BCL2L1-01        ggg-------------------gcgaccgtggccggagtgcttctg----
Q07816_BCL2L1-04        ggg-------------------gcgaccgtggccggagtgcttctg----
Q00709_BCL2-01          ggatctctctgaagaccatcctgagcctggttctggtgggagcttgcatc
A0A1L1RNM6_MCL1-01      gga-------------------gtggccggcctgggggcgagcttg----
A0A1L1RNM6_MCL1-02      gga-------------------gtggccggcctgggggcgagcttg----
                                              *   * *               *     

Q9W6F2_BCL2A1-01        gttcagagagtaccactga-------------------------------
Q07816_BCL2L1-03        ---ctgggatccctgctgagccgcaagtga--------------------
Q07816_BCL2L1-02        ---ctgggatccctgctgagccgcaagtga--------------------
Q07816_BCL2L1-01        ---ctgggatccctgctgagccgcaagtga--------------------
Q07816_BCL2L1-04        ---ctgggatccctgctgagccgcaagtgaccccatggttgtgtcccctg
Q00709_BCL2-01          actcttggcgcttatcttggacataagtag--------------------
A0A1L1RNM6_MCL1-01      ---------gcctacatgatccgaaagtggaggagttga-----------
A0A1L1RNM6_MCL1-02      ---------gcctacatgatccgg------------tga-----------

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        gcaccaggatggctgcgccttcacacatccaccacgcagctcccgagcac
Q00709_BCL2-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        catcaccatcacggggcgctcaccccgctccacggagcttccttcctcgc
Q00709_BCL2-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------

Q9W6F2_BCL2A1-01        -----------------------
Q07816_BCL2L1-03        -----------------------
Q07816_BCL2L1-02        -----------------------
Q07816_BCL2L1-01        -----------------------
Q07816_BCL2L1-04        gccgccagctccttttgtcgtag
Q00709_BCL2-01          -----------------------
A0A1L1RNM6_MCL1-01      -----------------------
A0A1L1RNM6_MCL1-02      -----------------------

© 1998-2020Legal notice