Dataset for CDS BCL-2-like of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-03      atgcacggagtccaacagggaactcatcaccgctttcttgagcgcctccg
                                                                          

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
A0A1L1RNM6_MCL1-01      ----------------------------------------atgggggtcg
A0A1L1RNM6_MCL1-03      tggacggactccgccgcagctcccggccctcagccggcggatgggggtcg
                                                                          

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
A0A1L1RNM6_MCL1-01      gccccgcgtccggcagcggagcgaagcggcccttgtggccctttttcacc
A0A1L1RNM6_MCL1-03      gccccgcgtccggcagcggagcgaagcggcccttgtggccctttttcacc
                                                                          

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
A0A1L1RNM6_MCL1-01      cccaaattccacttctcccccccgaggacaccccgagcgcggcacgaccg
A0A1L1RNM6_MCL1-03      cccaaattccacttctcccccccgaggacaccccgagcgcggcacgaccg
                                                                          

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-01        ----------------------atg-------------------------
Q00709_BCL2-01          ----------------------atggctcaccccgggagaaga-------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
A0A1L1RNM6_MCL1-01      ctccccgctcccctccccccgcgggggccgcaccggaagcggaaccgccc
A0A1L1RNM6_MCL1-03      ctccccgctcccctccccccgcgggggccgcaccggaagcggaaccgccc
                                                                          

Q9W6F2_BCL2A1-01        ------------------------------------------------at
Q07816_BCL2L1-01        --------------------------------------------tccagc
Q00709_BCL2-01          --------------------------------------------ggctac
A0A1L1RNM6_MCL1-02      --------------------------------------------------
A0A1L1RNM6_MCL1-01      ccccatggcgtcaccgcggccatataacagtcccggctttacccgcccgc
A0A1L1RNM6_MCL1-03      ccccatggcgtcaccgcggccatataacagtcccggctttacccgcccgc
                                                                          

Q9W6F2_BCL2A1-01        ggaaactgct--------------------gagtt--ctattacgtt---
Q07816_BCL2L1-01        agtaaccgg---------------------gagttagtgattga------
Q00709_BCL2-01          gacaaccgc---------------------gagatagtgctgaagta---
A0A1L1RNM6_MCL1-02      ------------------------------atgtttgcagtcaagcggaa
A0A1L1RNM6_MCL1-01      gccacccgccgccggtgctcgctgggcgccatgtttgcagtcaagcggaa
A0A1L1RNM6_MCL1-03      gccacccgccgccggtgctcgctgggcgccatgtttgcagtcaagcggaa
                                                        * *     *         

Q9W6F2_BCL2A1-01        ---tattatttagctcaagattatctgcagtatgt---------------
Q07816_BCL2L1-01        ---ctttgtttcctacaagctct--cacagagggggcactgctggagc--
Q00709_BCL2-01          ------catccactataaactct--cgcagcggggctacgactgggcc--
A0A1L1RNM6_MCL1-02      cgccgtcatcggcttcaacctctactgcggcggag-gaagcccgggcctg
A0A1L1RNM6_MCL1-01      cgccgtcatcggcttcaacctctactgcggcggag-gaagcccgggcctg
A0A1L1RNM6_MCL1-03      cgccgtcatcggcttcaacctctactgcggcggag-gaagcccgggcctg
                                *       **  *      * *                    

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-01        gagctgga-ggaagaggatgagaacag-----------------------
Q00709_BCL2-01          --gccggc-----------gaggacag-----gccgcccgtgcccccggc
A0A1L1RNM6_MCL1-02      gtgcccgcttcaccagcaggagagcaaaccccgccgcccgccgccgccgc
A0A1L1RNM6_MCL1-01      gtgcccgcttcaccagcaggagagcaaaccccgccgcccgccgccgccgc
A0A1L1RNM6_MCL1-03      gtgcccgcttcaccagcaggagagcaaaccccgccgcccgccgccgccgc
                                                                          

Q9W6F2_BCL2A1-01        ---------------------------------------gcttcag----
Q07816_BCL2L1-01        ---gactgacactgcagctgaggcagagatgg-acagcgtcctcaa----
Q00709_BCL2-01          cccggctcccgctgctgctcccgctgcggtg-----gctgctgctg----
A0A1L1RNM6_MCL1-02      tccggccgccgccgccgccaccgtcgctgaggtaccgcggccgctgattg
A0A1L1RNM6_MCL1-01      tccggccgccgccgccgccaccgtcgctgaggtaccgcggccgctgattg
A0A1L1RNM6_MCL1-03      tccggccgccgccgccgccaccgtcgctgaggtaccgcggccgctgattg
                                                                *  *      

Q9W6F2_BCL2A1-01        ---------------gaatcacatct------------------------
Q07816_BCL2L1-01        ------------tgggagcc-catcctggcac-------ccccctgc---
Q00709_BCL2-01          ---------------gagcctcctcccaccac-------cgccccgagcc
A0A1L1RNM6_MCL1-02      gctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgct
A0A1L1RNM6_MCL1-01      gctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgct
A0A1L1RNM6_MCL1-03      gctccgcggggctgtgggccgccgccggccgcgccgaagccccccgcgct
                                       *   * *  *                         

Q9W6F2_BCL2A1-01        -----------------------------------cggaccagcccaaac
Q07816_BCL2L1-01        -----------------------------------cggccacgtagtgaa
Q00709_BCL2-01          ccc--------------------------------cggctcggctgctgc
A0A1L1RNM6_MCL1-02      cccattggctccggggcggccccccacgctccgatcggttccgccgcggc
A0A1L1RNM6_MCL1-01      cccattggctccggggcggccccccacgctccgatcggttccgccgcggc
A0A1L1RNM6_MCL1-03      cccattggctccggggcggccccccacgctccgatcggttccgccgcggc
                                                           ***    *       

Q9W6F2_BCL2A1-01        c-----agagttgct-----------------------------------
Q07816_BCL2L1-01        c-----ggagccaccgt---------------------------------
Q00709_BCL2-01          tagtgaggtgcccccgg---------------------------------
A0A1L1RNM6_MCL1-02      ccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagcc
A0A1L1RNM6_MCL1-01      ccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagcc
A0A1L1RNM6_MCL1-03      ccgccgggcgccgccggactccacgtcgcggcccgtcgctctgtggagcc
                               * *   *                                    

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-01        ------------------------------------------gcaccgga
Q00709_BCL2-01          ctgagg-----------ggctgc-------------------gccccg--
A0A1L1RNM6_MCL1-02      ccgaggaggagttggacggctgcgagcccgagtccgaacgcggccccgga
A0A1L1RNM6_MCL1-01      ccgaggaggagttggacggctgcgagcccgagtccgaacgcggccccgga
A0A1L1RNM6_MCL1-03      ccgaggaggagttggacggctgcgagcccgagtccgaacgcggccccgga
                                                                          

Q9W6F2_BCL2A1-01        -----------------catgtcttgcgaaacatt---------------
Q07816_BCL2L1-01        gcagcctggaagttcatgaaattgttcgag-catccgacgtgaggcaggc
Q00709_BCL2-01          -------------------cgcctcccgg--cgtccacctcgc-------
A0A1L1RNM6_MCL1-02      ggcgattcgttgcccggcacgccgcccgagctgcccgacttga-------
A0A1L1RNM6_MCL1-01      ggcgattcgttgcccggcacgccgcccgagctgcccgacttga-------
A0A1L1RNM6_MCL1-03      ggcgattcgttgcccggcacgccgcccgagctgcccgacttga-------
                                                  **                      

Q9W6F2_BCL2A1-01        -----------------------------gcatcttcactccaagatcag
Q07816_BCL2L1-01        gctgagagatgcgggggat----------gagtttgagctgaggtaccgg
Q00709_BCL2-01          cctgcgccaggccggggac----------gagttctcgcgccgctaccag
A0A1L1RNM6_MCL1-02      tccccgacgagctgcggcaggaatccctggagctcatcctccggtacctc
A0A1L1RNM6_MCL1-01      tccccgacgagctgcggcaggaatccctggagctcatcctccggtacctc
A0A1L1RNM6_MCL1-03      tccccgacgagctgcggcaggaatccctggagctcatcctccggtacctc
                                                     *        *      * *  

Q9W6F2_BCL2A1-01        acagaggaggc------tctcagacccttcttggacaggatcgatattac
Q07816_BCL2L1-01        agggcttt-----cagcgacctcacctccc-------agctccacat--c
Q00709_BCL2-01          agggacttcgc-ccagatgtcgggcc-----------agctgcacctgac
A0A1L1RNM6_MCL1-02      cgggaggcggcgggagaggccgagcccggcgttaaaaagctgtttccggg
A0A1L1RNM6_MCL1-01      cgggaggcggcgggagaggccgagcccggcgttaaaaagctgtttccggg
A0A1L1RNM6_MCL1-03      cgggaggcggcgggagaggccgagcccggcgttaaaaagctgtttccggg
                           *                *   **            * *         

Q9W6F2_BCL2A1-01        ctccgt------------------agatgttgccaagagaattttcaatg
Q07816_BCL2L1-01        acccct-------------------ggcacggcgtaccagagctttgagc
Q00709_BCL2-01          gccctt---------------------cacggcccacggccgcttcgtgg
A0A1L1RNM6_MCL1-02      gctcctgggagggccagggcggcccggcagggcgagcagcgccgtcatgg
A0A1L1RNM6_MCL1-01      gctcctgggagggccagggcggcccggcagggcgagcagcgccgtcatgg
A0A1L1RNM6_MCL1-03      gctcctgggagggccagggcggcccggcagggcgagcagcgccgtcatgg
                           * *                         **           *     

Q9W6F2_BCL2A1-01        g------------------------------------agtcatggaagaa
Q07816_BCL2L1-01        a------------------------------------ggtagtgaatgaa
Q00709_BCL2-01          c------------------------------------cgtggtggaggag
A0A1L1RNM6_MCL1-02      agaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaa
A0A1L1RNM6_MCL1-01      agaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaa
A0A1L1RNM6_MCL1-03      agaaagcgctggaaacgttgcggagggtcggggacggcgtgatgcagaaa
                                                              **  ** *  * 

Q9W6F2_BCL2A1-01        a-------------------------------------------------
Q07816_BCL2L1-01        c-------------------------------------------------
Q00709_BCL2-01          c-------------------------------------------------
A0A1L1RNM6_MCL1-02      cacgaattggccttccagggaatgcttcggaagctggaaatcaaaaagga
A0A1L1RNM6_MCL1-01      cacgaattggccttccagggaatgcttcggaagctggaaatcaaaaagga
A0A1L1RNM6_MCL1-03      cacgaattggccttccagggaatgcttcggaagctggaaatcaaaaagga
                                                                          

Q9W6F2_BCL2A1-01        --------------------------------------aatttgctgatg
Q07816_BCL2L1-01        --------------------------------------tcttccatgatg
Q00709_BCL2-01          --------------------------------------tcttccgtgatg
A0A1L1RNM6_MCL1-02      agatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatg
A0A1L1RNM6_MCL1-01      agatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatg
A0A1L1RNM6_MCL1-03      agatgacctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatg
                                                                **   *****

Q9W6F2_BCL2A1-01        gaaatactaactggggacgaattatgaccatatttacttttggaggtctt
Q07816_BCL2L1-01        gtgt---gaactgggggcgcatcgtggctttcttctccttcggaggg---
Q00709_BCL2-01          gggt---caactggggccggatcgtcgccttcttcgagttcggcggc---
A0A1L1RNM6_MCL1-02      gagtaacaaactggggccgagttgtcacgctcatctcatttggtgccttt
A0A1L1RNM6_MCL1-01      gagtaacaaactggggccgagttgtcacgctcatctcatttggtgccttt
A0A1L1RNM6_MCL1-03      gagtaacaaactggggccgagttgtcacgctcatctcatttggtgccttt
                        *       ******** **  *  *  *  *  *    ** ** *     

Q9W6F2_BCL2A1-01        ctcaccaagaagcttcaagagcacgga------------gttcagctcac
Q07816_BCL2L1-01        ---g-ctttgtgcgtggagagcgtggacaaggagatgcgggt------ac
Q00709_BCL2-01          ---g-tgatgtgcgtcgagagcgtcaaccgggagatgt------cgccgc
A0A1L1RNM6_MCL1-02      gttg-caaaacacctgaaaagcatcaaccaagagaaatgcatcacctcgc
A0A1L1RNM6_MCL1-01      gttg-caaaacacctgaaaagcatcaaccaagagaaatgcatcacctcgc
A0A1L1RNM6_MCL1-03      gttg-caaaacacctgaaaagcatcaaccaagagaaatgcatcacctcgc
                                    * *  * ***    *                      *

Q9W6F2_BCL2A1-01        tggagaggagaaggagaagatttcttatttcatcacagagtacatcataa
Q07816_BCL2L1-01        tgg--------tgggacgcattgtgtcttggatgaccacgtacttgaccg
Q00709_BCL2-01          tgg--------tggacaacattgccacctggatgaccgagtacctgaacc
A0A1L1RNM6_MCL1-02      tgg--------cggggatcatcac-----ggacgcattggt--ctcatcc
A0A1L1RNM6_MCL1-01      tgg--------cggggatcatcac-----ggacgcattggt--ctcatcc
A0A1L1RNM6_MCL1-03      tgg--------cggggatcatcac-----ggacgcattggt--ctcatcc
                        ***         **     **          *       **   * *   

Q9W6F2_BCL2A1-01        ataacaaagccgcatggatagatgcaaacggtggctgggtaagtttc---
Q07816_BCL2L1-01        accatctagatccctggatccaggagaatggcggctgggagcgctttgtg
Q00709_BCL2-01          ggcacctgcacaactggatccaggacaacggaggatgggatgcctttgtg
A0A1L1RNM6_MCL1-02      aa-----acgcgagtggctgatgagccagggaggctgggagggctttgtt
A0A1L1RNM6_MCL1-01      aa-----acgcgagtggctgatgagccagggaggctgggagggctttgtt
A0A1L1RNM6_MCL1-03      aa-----acgcgagtggctgatgagccagggaggctgggagggctttgtt
                                      *** *        * ** ** ****     **    

Q9W6F2_BCL2A1-01        ---------------aattt------------------------------
Q07816_BCL2L1-01        gatctgtatgggaacaacgctgctgccgagctgaggaagggc--------
Q00709_BCL2-01          gaattgtacggcaacagtat----------------gaggcctttgttcg
A0A1L1RNM6_MCL1-02      gacttcttccg----agt-t----------------gaggac--------
A0A1L1RNM6_MCL1-01      gacttcttccg----agt-t----------------gaggac--------
A0A1L1RNM6_MCL1-03      gacttcttccg----agt-t----------------gaggac--------
                                       *                                  

Q9W6F2_BCL2A1-01        ---------------------------------ggtgtcttctcatt---
Q07816_BCL2L1-01        -----------------caggagaccttcaacaaatggctcctcaccggg
Q00709_BCL2-01          atttctcctggatctctctgaagaccatcctgagcctggttctggtggga
A0A1L1RNM6_MCL1-02      -----------------ctggaaagcagcatcaggaatgtgctgat-ggc
A0A1L1RNM6_MCL1-01      -----------------ctggaaagcagcatcaggaatgtgctgat-ggc
A0A1L1RNM6_MCL1-03      -----------------ctggaaagcagcatcaggaatgtgctgat-ggc
                                                               * **       

Q9W6F2_BCL2A1-01        -------ttccagcacagcgtagattcaaacatttgtcttaa--------
Q07816_BCL2L1-01        gcgaccgtggccggagtgcttctgct--gggatccctgctgagccgcaag
Q00709_BCL2-01          gc-----ttgcatcact------ctt--ggcgcttatcttgg---acata
A0A1L1RNM6_MCL1-02      ct-----ttgcaggagtggccggcct--gggggcgagcttggcctacatg
A0A1L1RNM6_MCL1-01      ct-----ttgcaggagtggccggcct--gggggcgagcttggcctacatg
A0A1L1RNM6_MCL1-03      ct-----ttgcaggagtggccggcct--gggggcgagcttggcctacatg
                               *  *   *          *             *          

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q00709_BCL2-01          agtag---------------------------------------------
A0A1L1RNM6_MCL1-02      atccgcccaggaccccacccgcggcctccggggatggggcacccacagaa
A0A1L1RNM6_MCL1-01      atccg---------------------------------------------
A0A1L1RNM6_MCL1-03      atccg---------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
Q00709_BCL2-01          --------------------------------------------------
A0A1L1RNM6_MCL1-02      cgaggcagcagtgacagcagctcggggcctccaggtaaggaacttcttcc
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-03      --------------------------------------------------
                                                                          

Q9W6F2_BCL2A1-01        --------------------------------
Q07816_BCL2L1-01        -----------------------------tga
Q00709_BCL2-01          --------------------------------
A0A1L1RNM6_MCL1-02      tcacaggcgacctcaataaatggctgttttaa
A0A1L1RNM6_MCL1-01      ----------------aaagtggaggagttga
A0A1L1RNM6_MCL1-03      ----------------g------------tga
                                                        

© 1998-2022Legal notice