Dataset for CDS BAK1 of Organism Bos mutus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|L8IT09_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Bos mutus GN=BAK1 (length=615 residues).
atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcctgacccctcctccacctcagaggagcaggt
agcccgggacaccgaggaggtcttccgcagctacgaacaggaggccgagggggcggctgcgcctactgacccagagatgg
tcaccttgcacccagaacctagcagcaccatggggcaggtgggccgccagctcgccgtcatcggggacgacatcaaccgg
cgctatgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgcctatgagtacttcaccaagat
cgcgtccagcctgtttgagagcggtatcaactggggccgcgtggtggctctgctgggctttggctaccgcctggccctcc
acgtctaccagcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgacttcatgctgcgtcgctccatc
gcccggtggatcgcgcagaggggtggctgggtggcagccctggacttggggaacggccccatcaagagcgtagccatcgt
tctggctgtggttttgttgggccagtttgtggtacgaagattcttcaagtcatga
>gnl|bcl2dbcds|L8IT09_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Bos mutus GN=BAK1 (length=588 residues).
atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcctgacccctcctccacctcagaggagcaggt
agcccgggacaccgaggaggtcttccgcagctacgtcttttaccgccccaactcactggccgcctcccgctcctccagca
ccatggggcaggtgggccgccagctcgccgtcatcggggacgacatcaaccggcgctatgatgcggagttccaggccatg
ctgcagcacctgcagccaacagcagacaacgcctatgagtacttcaccaagatcgcgtccagcctgtttgagagcggtat
caactggggccgcgtggtggctctgctgggctttggctaccgcctggccctccacgtctaccagcgcggcctgaccggct
tcctgggccaggtgacccgcttcgtggccgacttcatgctgcgtcgctccatcgcccggtggatcgcgcagaggggtggc
tgggtggcagccctggacttggggaacggccccatcaagagcgtagccatcgttctggctgtggttttgttgggccagtt
tgtggtacgaagattcttcaagtcatga
© 1998-2020Legal notice