Dataset for CDS BAK1 of Organism Bos mutus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


L8IT09_BAK1-01      atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcctgacccctcc
L8IT09_BAK1-02      atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcctgacccctcc
                    ************************************************************

L8IT09_BAK1-01      tccacctcagaggagcaggtagcccgggacaccgaggaggtcttccgcagctacgaacag
L8IT09_BAK1-02      tccacctcagaggagcaggtagcccgggacaccgaggaggtcttccgcagctacgtcttt
                    *******************************************************     

L8IT09_BAK1-01      gaggccgagggggcggctgcgcctactgacccagagatggtcaccttgcacccagaacct
L8IT09_BAK1-02      ta--------------ccgccccaactcac-------tggccgcctcccgc------tcc
                     *              * ** ** *** **       *** * ***  * *       * 

L8IT09_BAK1-01      agcagcaccatggggcaggtgggccgccagctcgccgtcatcggggacgacatcaaccgg
L8IT09_BAK1-02      tccagcaccatggggcaggtgggccgccagctcgccgtcatcggggacgacatcaaccgg
                      **********************************************************

L8IT09_BAK1-01      cgctatgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgcc
L8IT09_BAK1-02      cgctatgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgcc
                    ************************************************************

L8IT09_BAK1-01      tatgagtacttcaccaagatcgcgtccagcctgtttgagagcggtatcaactggggccgc
L8IT09_BAK1-02      tatgagtacttcaccaagatcgcgtccagcctgtttgagagcggtatcaactggggccgc
                    ************************************************************

L8IT09_BAK1-01      gtggtggctctgctgggctttggctaccgcctggccctccacgtctaccagcgcggcctg
L8IT09_BAK1-02      gtggtggctctgctgggctttggctaccgcctggccctccacgtctaccagcgcggcctg
                    ************************************************************

L8IT09_BAK1-01      accggcttcctgggccaggtgacccgcttcgtggccgacttcatgctgcgtcgctccatc
L8IT09_BAK1-02      accggcttcctgggccaggtgacccgcttcgtggccgacttcatgctgcgtcgctccatc
                    ************************************************************

L8IT09_BAK1-01      gcccggtggatcgcgcagaggggtggctgggtggcagccctggacttggggaacggcccc
L8IT09_BAK1-02      gcccggtggatcgcgcagaggggtggctgggtggcagccctggacttggggaacggcccc
                    ************************************************************

L8IT09_BAK1-01      atcaagagcgtagccatcgttctggctgtggttttgttgggccagtttgtggtacgaaga
L8IT09_BAK1-02      atcaagagcgtagccatcgttctggctgtggttttgttgggccagtttgtggtacgaaga
                    ************************************************************

L8IT09_BAK1-01      ttcttcaagtcatga
L8IT09_BAK1-02      ttcttcaagtcatga
                    ***************

© 1998-2020Legal notice