Dataset for CDS BAX-like of Organism Cyprinodon variegatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2DRF3_BOK-01      ------atgg-----------------------------------atgtt
A0A3Q2E537_BAX-01      ------atggcagaaggaggtggaggtgac------------caagggaa
A0A3Q2CP03_BAX-02      ------atgctagcatcacat-------------actagccaagaaaggg
A0A3Q2CP03_BAX-01      ---------------------------------------------atgtg
A0A3Q2CP03_BAX-03      tctttcatacaaacattacagtgttgtggtgctagttacctacaaatgtg
                                                                      *  

A0A3Q2DRF3_BOK-01      ctccggcggtcctct--------------atgtttgcctcagaggtgctg
A0A3Q2E537_BAX-01      tccggttgatcctatggtggaagttggagctgtgttgctaaagga-----
A0A3Q2CP03_BAX-02      tct--ctagcatttt--------------atgcttaaacaataca---tc
A0A3Q2CP03_BAX-01      tcttatctgtactct--------------ctactctctccaaatgttttc
A0A3Q2CP03_BAX-03      tcttatctgtactct--------------ctactctctccaaatgttttc
                                   * *               *         *         

A0A3Q2DRF3_BOK-01      gatgtctttgaccgatcagtgaccgagaaagagctggtgtctcagtccaa
A0A3Q2E537_BAX-01      ------tttcatctaccagcgg---------------------attcggc
A0A3Q2CP03_BAX-02      tat---tttcgtcgtgaagtgg---------------------attcagc
A0A3Q2CP03_BAX-01      tag---tttcgtcgtgaagtgg---------------------attcagc
A0A3Q2CP03_BAX-03      tag---tttcgtcgtgaagtgg---------------------attcagc
                             ***   *    ** *                      * **   

A0A3Q2DRF3_BOK-01      agcactttgcagagactacatcctttccaggctcaaccagaatggattag
A0A3Q2E537_BAX-01      ggcacgt--------agacggcgatactgatgtgacccgggaacagttgg
A0A3Q2CP03_BAX-02      gacatgcattaagtaaggtgccgatcct--------ccaggaagcgttgg
A0A3Q2CP03_BAX-01      gacatgcattaagtaaggtgccgatcct--------ccaggaagcgttgg
A0A3Q2CP03_BAX-03      gacatgcattaagtaaggtgccgatcct--------ccaggaagcgttgg
                         **                 *  * *         ** * *    ** *

A0A3Q2DRF3_BOK-01      gatggtccaaaactgaacttaacttctctccctctaatgcagcagtcgct
A0A3Q2E537_BAX-01      g----------------tgccacggagctatgtgacccaaaccattta--
A0A3Q2CP03_BAX-02      g----------------tgtaacagctctctgtgacccacagcagcag--
A0A3Q2CP03_BAX-01      g----------------tgtaacagctctctgtgacccacagcagcag--
A0A3Q2CP03_BAX-03      g----------------tgtaacagctctctgtgacccacagcagcag--
                       *                    **    **   *       * **      

A0A3Q2DRF3_BOK-01      gaagtgtctcaggtgcttctttgtcttggcgatgagttggaaagcataca
A0A3Q2E537_BAX-01      aagctcgctcagtgtctccagcagattggagatgagctggatggaa----
A0A3Q2CP03_BAX-02      aaagtctctgatgcctttcaggttgttgcggatgaa--------------
A0A3Q2CP03_BAX-01      aaagtctctgatgcctttcaggttgttgcggatgaa--------------
A0A3Q2CP03_BAX-03      aaagtctctgatgcctttcaggttgttgcggatgaagtggatggag----
                        *  *  ** *     * *      ***  *****               

A0A3Q2DRF3_BOK-01      gcccactctgtacaggaacgtggcaaggcagcttaacatttc------cg
A0A3Q2E537_BAX-01      -----------acatggagctgcagaggatgatagaggactctgccctca
A0A3Q2CP03_BAX-02      -------------------------------------gttccatcattca
A0A3Q2CP03_BAX-01      -------------------------------------gttccatcattca
A0A3Q2CP03_BAX-03      -----------aaggagggattaaaaagctaatagaggttccatcattca
                                                                *      * 

A0A3Q2DRF3_BOK-01      ttgccatggagaatgttgtttcagatgccttcctcagcgtggcaacggag
A0A3Q2E537_BAX-01      aaccaacaaaa------------gatgtcttcatgaaagtggcacttcag
A0A3Q2CP03_BAX-02      ctccctcaaag------------gaagtgtttgtgaaaattgtccgcgaa
A0A3Q2CP03_BAX-01      ctccctcaaag------------gaagtgtttgtgaaaattgtccgcgaa
A0A3Q2CP03_BAX-03      ctccctcaaag------------gaagtgtttgtgaaaattgtccgcgaa
                          *     *             ** *  **  * *   * *      * 

A0A3Q2DRF3_BOK-01      atctttgcagcaggta---ttacatggggtaaagtggtagccatgtatgc
A0A3Q2E537_BAX-01      atcttttctgatggtagattcaactggggtcgagtggttgcgctgttct-
A0A3Q2CP03_BAX-02      ctcttttccgatggggagatcaactggggcagggtggttaccgtcttct-
A0A3Q2CP03_BAX-01      ctcttttccgatggggagatcaactggggcagggtggttaccgtcttct-
A0A3Q2CP03_BAX-03      ctcttttccgatggggagatcaactggggcagggtggttaccgtcttct-
                        ***** * *  **     * *  *****    *****  *  * *    

A0A3Q2DRF3_BOK-01      ggtagctggagccctggcagtagactgtgtcagacagggacaccccacaa
A0A3Q2E537_BAX-01      ----------actttgcctgtcgact-cgtcataaaagcccttatcacca
A0A3Q2CP03_BAX-02      ----------gctttgccggcatgtt-tgtcttgaaagctcatgaaagca
A0A3Q2CP03_BAX-01      ----------gctttgccggcatgtt-tgtcttgaaagctcatgaaagca
A0A3Q2CP03_BAX-03      ----------gctttgccggcatgtt-tgtcttgaaagctcatgaaagca
                                  *  ** * *     *  ***    * *  *     *  *

A0A3Q2DRF3_BOK-01      cagtgc------------acattatagtggacagtcttggacagtttgtc
A0A3Q2E537_BAX-01      aaattccagaaatcatcagaactataatcaactggaccatagactacatc
A0A3Q2CP03_BAX-02      aaatatgtgagttaatcaaaaccataatcagctggatcatagactttttc
A0A3Q2CP03_BAX-01      aaatatgtgagttaatcaaaaccataatcagctggatcatagactttttc
A0A3Q2CP03_BAX-03      aaatatgtgagttaatcaaaaccataatcagctggatcatagactttttc
                        * *                *  *** *   * *      * * *   **

A0A3Q2DRF3_BOK-01      cgtaagtttctcgtccattggctgaagaggaaaggaggatgggcagaaat
A0A3Q2E537_BAX-01      cgggatcatgtgatcaactggatcagagagcaaggtggctgggagggtat
A0A3Q2CP03_BAX-02      cgagaaaaggtgcttggctggataaaggagcaaggcggctgggagggaat
A0A3Q2CP03_BAX-01      cgagaaaaggtgcttggctggataaaggagcaaggcggctgggagggaat
A0A3Q2CP03_BAX-03      cgagaaaaggtgcttggctggataaaggagcaaggcggctgggagggaat
                       **  *     *  *    *** * *    * **** ** ****  *  **

A0A3Q2DRF3_BOK-01      catgaagtgcgtggtgaaaatggactgcacccctgaacggc----cttgg
A0A3Q2E537_BAX-01      tcgctcctactt------------cggcacgcctacatggcagacggtgg
A0A3Q2CP03_BAX-02      tttttcctacgt------------cggcattcccatgtggcaatttttgg
A0A3Q2CP03_BAX-01      tttttcctacgt------------cggcattcccatgtggcaatttttgg
A0A3Q2CP03_BAX-03      tttttcctacgt------------cggcattcccatgtggcaatttttgg
                              * * *            * ***  **     ***      ***

A0A3Q2DRF3_BOK-01      ctatcat-ctgtcatggattccttcaaatattttctcactacagtgtatg
A0A3Q2E537_BAX-01      gtgtcttcctggctggagttcttgccactgtttttgt-----------ca
A0A3Q2CP03_BAX-02      ggatttttctggctggggttgtcaccacccttgtcgt-----------cg
A0A3Q2CP03_BAX-01      ggatttttctggctggggttgtcaccacccttcaaac-----------ca
A0A3Q2CP03_BAX-03      ggatttttctggctggggttgtcaccacccttgtcgt-----------cg
                          *  * *** *  *  **    * *   **                  

A0A3Q2DRF3_BOK-01      tctacatcatgaagg---------agcagtga
A0A3Q2E537_BAX-01      tgcgcaagatg------------------tga
A0A3Q2CP03_BAX-02      tccacaagatgaggg---------ccgaatga
A0A3Q2CP03_BAX-01      ---agaagttaatgggaggatttacagagtaa
A0A3Q2CP03_BAX-03      tccacaagatgaggg---------ccgaatga
                            *   *                   * *

© 1998-2023Legal notice