Dataset for CDS BAK1 of Organism Chelonoidis abingdonii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0GSV4_BAK1-03      atgaggataaggaggagtttcctcactcctgtgcactccagaggagctgc
A0A8C0GSV4_BAK1-01      ---agaacaagtgg------------------------------------
A0A8C0GSV4_BAK1-02      atgaggataaggaggagtttcctcactcctgtgcactccagaggagctgc
                           ** * ***  *                                    

A0A8C0GSV4_BAK1-03      ctgcctgaccctgccaatcattgtctccccctcagaagatcaggtggccc
A0A8C0GSV4_BAK1-01      --acataaacaggcca----------------tgaaagatcaggtggccc
A0A8C0GSV4_BAK1-02      ctgcctgaccctgccaatcattgtctccccctcagaagatcaggtggccc
                           * * * *  ****                   ***************

A0A8C0GSV4_BAK1-03      aggagaccgaggaggtgttccggagctatgccttccaccgctaccagcag
A0A8C0GSV4_BAK1-01      aggagaccgaggaggtgttccggagctatgccttccaccgctaccagcag
A0A8C0GSV4_BAK1-02      aggagaccgaggaggtgttccggagctatgccttccaccgctaccagcag
                        **************************************************

A0A8C0GSV4_BAK1-03      gagagggaagagggcggaggggaggtgccgatggaccccgagattgcaga
A0A8C0GSV4_BAK1-01      gagagggaagagggcggaggggaggtgccgatggaccccgagattgcaga
A0A8C0GSV4_BAK1-02      gagagggaagagggcggaggggaggtgccgatggaccccgagattgcaga
                        **************************************************

A0A8C0GSV4_BAK1-03      gatccagcaggagccgggcagcaccagtaaccaggtgggcaggcgcctgg
A0A8C0GSV4_BAK1-01      gatccagcaggagccgggcagcaccagtaaccaggtgggcaggcgcctgg
A0A8C0GSV4_BAK1-02      gatccagcaggagccgggcagcaccagtaaccaggtgggcaggcgcctgg
                        **************************************************

A0A8C0GSV4_BAK1-03      ccatcattggagatgacatcaacatgcggtatgacgcagagttccagaac
A0A8C0GSV4_BAK1-01      ccatcattggagatgacatcaacatgcggtatgacgcagagttccagaac
A0A8C0GSV4_BAK1-02      ccatcattggagatgacatcaacatgcggtatgacgcagagttccagaac
                        **************************************************

A0A8C0GSV4_BAK1-03      atgctgaagaccctgcagcccacgaaggacaatgcctacgagtacttcac
A0A8C0GSV4_BAK1-01      atgctgaagaccctgcagcccacgaaggacaatgcctacgagtacttcac
A0A8C0GSV4_BAK1-02      atgctgaagaccctgcagcccacgaaggacaatgcctacgagtacttcac
                        **************************************************

A0A8C0GSV4_BAK1-03      taagatagcctccagcttgtttgacagcggcattaactggggcagggtga
A0A8C0GSV4_BAK1-01      taagatagcctccagcttgtttgacagcggcattaactggggcagggtga
A0A8C0GSV4_BAK1-02      taagatagcctccagcttgtttgacagcggcattaactggggcagggtga
                        **************************************************

A0A8C0GSV4_BAK1-03      ttgcgctgctggggttcggttaccggatggcgattcatgtgtaccagcac
A0A8C0GSV4_BAK1-01      ttgcgctgctggggttcggttaccggatggcgattcatgtgtaccagcac
A0A8C0GSV4_BAK1-02      ttgcgctgctggggttcggttaccggatggcgattcatgtgtaccagcac
                        **************************************************

A0A8C0GSV4_BAK1-03      ggggtgaccggcttcctccggagcattgctcgctacgtggcagaattcgt
A0A8C0GSV4_BAK1-01      ggggtgaccggcttcctccggagcattgctcgctacgtggcagaattcgt
A0A8C0GSV4_BAK1-02      ggggtgaccggcttcctccggagcattgctcgctacgtggcagaattcgt
                        **************************************************

A0A8C0GSV4_BAK1-03      gctccgcaaccgcatcgcccagtggatcgccgaccaaggaggatgggtaa
A0A8C0GSV4_BAK1-01      gctccgcaaccgcatcgcccagtggatcgccgaccaaggaggatgggtgg
A0A8C0GSV4_BAK1-02      gctccgcaaccgcatcgcccagtggatcgccgaccaaggaggatgggtgg
                        ************************************************  

A0A8C0GSV4_BAK1-03      gtgagcctggctt--------------ttttttctctggaggg-------
A0A8C0GSV4_BAK1-01      cagcactggagttggataacgtttacgtattgtacatgatgggggtgttg
A0A8C0GSV4_BAK1-02      cagcactggagttggataacgtttacgtattgtacatgatgggggtgttg
                          *  *  *  **              * ** *   **  ***       

A0A8C0GSV4_BAK1-03      ---------cagctgagcc----ggtgctgccaagtttgtccaaaaagca
A0A8C0GSV4_BAK1-01      gtcgtggtcctgctgggtcatttggtggtacgacgcttctt-------ca
A0A8C0GSV4_BAK1-02      gtcgtggtcctgctgggtcatttggtggtacgacgcttctt-------ca
                                 * **** * *    **** * * * * ** *        **

A0A8C0GSV4_BAK1-03      acccaggtgatgtctga
A0A8C0GSV4_BAK1-01      gccca---------tga
A0A8C0GSV4_BAK1-02      gccca---------tga
                         ****         ***

© 1998-2023Legal notice