Dataset for CDS MCL-1 of organism Sphaeramia orbicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673A8P7_MCL1-02      atgttaatcgcgagtttaaagttactgattaagatgaatattattccccc
A0A673A8P7_MCL1-01      atgttaatcgcgagtttaaagttactgattaagatgaatattattccccc
A0A673A8P7_MCL1-03      atgttaatcgcgagtttaaagttactgattaagatgaatattattccccc
A0A673A8P7_MCL1-04      atgttaatcgcgagtttaaagttactgattaagatgaatattattccccc
                        **************************************************

A0A673A8P7_MCL1-02      atcaaagcgtactgcgtttggaatcatgagtgtttctttgcttcatcaaa
A0A673A8P7_MCL1-01      atcaaagcgtactgcgtttggaatcatgagtgtttctttgcttcatcaaa
A0A673A8P7_MCL1-03      atcaaagcgtactgcgtttggaatcatgagtgtttctttgcttcatcaaa
A0A673A8P7_MCL1-04      atcaaagcgtactgcgtttggaatcatgagtgtttctttgcttcatcaaa
                        **************************************************

A0A673A8P7_MCL1-02      atggagtcgcggatcctttcggagcagaggactcagcccagtttatccgg
A0A673A8P7_MCL1-01      atggagtcgcggatcctttcggagcagaggactcagcccagtttatccgg
A0A673A8P7_MCL1-03      atggagtcgcggatcctttcggagcagaggactcagcccagtttatccgg
A0A673A8P7_MCL1-04      atggagtcgcggatcctttcggagcagaggactcagcccagtttatccgg
                        **************************************************

A0A673A8P7_MCL1-02      gactcagcccagttcaaccgggcctcggccttggactctcggaacagcaa
A0A673A8P7_MCL1-01      gactcagcccagttcaaccgggcctcggccttggactctcggaacagcaa
A0A673A8P7_MCL1-03      gactcagcccagttcaaccgggcctcggccttggactctcggaacagcaa
A0A673A8P7_MCL1-04      gactcagcccagttcaaccgggcctcggccttggactctcggaacagcaa
                        **************************************************

A0A673A8P7_MCL1-02      tccacagcaccgacccaacaatctgggagtgaaagcaaaaaacgagcact
A0A673A8P7_MCL1-01      tccacagcaccgacccaacaatctgggagtgaaagcaaaaaacgagcact
A0A673A8P7_MCL1-03      tccacagcaccgacccaacaatctgggagtgaaagcaaaaaacgagcact
A0A673A8P7_MCL1-04      tccacagcaccgacccaacaatctgggagtgaaagcaaagaacgagcact
                        *************************************** **********

A0A673A8P7_MCL1-02      tacccaaaagccttcaggaggaccgggatgaggcggacgcggacggctct
A0A673A8P7_MCL1-01      tacccaaaagccttcaggaggaccgggatgaggcggacgcggacggctct
A0A673A8P7_MCL1-03      tacccaaaagccttcaggaggaccgggatgaggcggacgcggacggctct
A0A673A8P7_MCL1-04      tacccaaaagccttcaggaggaccgggatgaggcggacgcggacggctct
                        **************************************************

A0A673A8P7_MCL1-02      ctgccctgtacgccggagttccagtccctggagccggacgtgcccagctg
A0A673A8P7_MCL1-01      ctgccctgtacgccggagttccagtccctggagccggacgtgcccagctg
A0A673A8P7_MCL1-03      ctgccctgtacgccggagttccagtccctggagccggacgtgcccagctg
A0A673A8P7_MCL1-04      ctgccctgtacgccggagttccagtccctggagccggacgtgcccagctg
                        **************************************************

A0A673A8P7_MCL1-02      cccggcgggacatgaagtcctggaggccgacacaaggcagcttattatcg
A0A673A8P7_MCL1-01      cccggcgggacatgaagtcctggaggccgacacaaggcagcttattatcg
A0A673A8P7_MCL1-03      cccggcgggacatgaagtcctggaggccgacacaaggcagcttattatcg
A0A673A8P7_MCL1-04      cccggcgggacatgaagtcctggaggccgacacaaggcagcttattatcg
                        **************************************************

A0A673A8P7_MCL1-02      gcttcctcaaagtctttacaggagtttcgaaacctcggtggagtcaaaac
A0A673A8P7_MCL1-01      gcttcctcaaagtctttacaggagtttcgaaacctcggtggagtcaaaac
A0A673A8P7_MCL1-03      gcttcctcaaagtctttacaggagtttcgaaacctcggtggagtcaaaac
A0A673A8P7_MCL1-04      gcttcctcaaagtctttacaggagtttcgaaacctcggtggagtcaaaac
                        **************************************************

A0A673A8P7_MCL1-02      gaagcactatcaacaatgaaaagagttgtggaggaccttttggaaaaaca
A0A673A8P7_MCL1-01      gaagcactatcaacaatgaaaagagttgtggaggaccttttggaaaaaca
A0A673A8P7_MCL1-03      gaagcactatcaacaatgaaaagagttgtggaggaccttttggaaaaaca
A0A673A8P7_MCL1-04      gaagcactatcaacaatgaaaagagttgtggaggaccttttggaaaaaca
                        **************************************************

A0A673A8P7_MCL1-02      cagatacgcatacaatggtatgatcaacaaattgtcattggatgacagag
A0A673A8P7_MCL1-01      cagatacgcatacaatggtatgatcaacaaattgtcattggatgacagag
A0A673A8P7_MCL1-03      cagatacgcatacaatggtatgatcaacaaattgtcattggatgacagag
A0A673A8P7_MCL1-04      cagatacgcatacaatggtatgatcaacaaattgtcattggatgacagag
                        **************************************************

A0A673A8P7_MCL1-02      gagatgatatgaggttcgtaagtgcagtagcaacaagtctctttgaagat
A0A673A8P7_MCL1-01      gagatgatatgaggttcgtaagtgcagtagcaacaagtctctttgaagat
A0A673A8P7_MCL1-03      gagatgatatgaggttcgtaagtgcagtagcaacaagtctctttgaagat
A0A673A8P7_MCL1-04      gagatgatatgaggttcgtaagtgcagtagcaacaagtctctttgaagat
                        **************************************************

A0A673A8P7_MCL1-02      gggaccacgaactggggtcgtgttgccagcctggtggccttcggggcagt
A0A673A8P7_MCL1-01      gggaccacgaactggggtcgtgttgccagcctggtggccttcggggcagt
A0A673A8P7_MCL1-03      gggaccacgaactggggtcgtgttgccagcctggtggccttcggggcagt
A0A673A8P7_MCL1-04      gggaccacgaactggggtcgtgttgccagcctggtggccttcggggcagt
                        **************************************************

A0A673A8P7_MCL1-02      ggtgtgtcagtatcttaagaagaaaggcagggaaaactgtgtggagctgg
A0A673A8P7_MCL1-01      ggtgtgtcagtatcttaagaagaaaggcagggaaaactgtgtggagctgg
A0A673A8P7_MCL1-03      ggtgtgtcagtatcttaagaagaaaggcagggaaaactgtgtggagctgg
A0A673A8P7_MCL1-04      ggtgtgtcagtatcttaagaagaaaggcagggaaaactgtgtggagctgg
                        **************************************************

A0A673A8P7_MCL1-02      tgggagaagagatttcagcatatctgctgtctgatcagcgagactggctg
A0A673A8P7_MCL1-01      tgggagaagagatttcagcatatctgctgtctgatcagcgagactggctg
A0A673A8P7_MCL1-03      tgggagaagagatttcagcatatctgctgtctgatcagcgagactggctg
A0A673A8P7_MCL1-04      tgggagaagagatttcagcatatctgctgtctgatcagcgagactggctg
                        **************************************************

A0A673A8P7_MCL1-02      ctcaaaaacaactcctgggacggctttgtagagttcttccgagtatcaga
A0A673A8P7_MCL1-01      ctcaaaaacaactcctgggacggctttgtagagttcttccgagtatcaga
A0A673A8P7_MCL1-03      ctcaaaaacaactcctgggacggctttgtagagttcttccgagtatcaga
A0A673A8P7_MCL1-04      ctcaaaaacaactcctgggacggctttgtagagttcttccgagtatcaga
                        **************************************************

A0A673A8P7_MCL1-02      cccagaatcaacagtgaggaacacactgatgaccgtggctggattagctg
A0A673A8P7_MCL1-01      cccagaatcaacagtgaggaacacactgatgaccgtggctggattagctg
A0A673A8P7_MCL1-03      cccagaatcaacagtgaggaacacactgatgaccgtggctggattagctg
A0A673A8P7_MCL1-04      cccagaatcaacagtgaggaacacactgatgaccgtggctggattagctg
                        **************************************************

A0A673A8P7_MCL1-02      gtattggggcaacactggccatgttaatcaggtga
A0A673A8P7_MCL1-01      gtattggggcaacactggccatgttaatcaggtga
A0A673A8P7_MCL1-03      gtattggggcaacactggccatgttaatcaggtga
A0A673A8P7_MCL1-04      gtattggggcaacactggccatgttaatcaggtga
                        ***********************************

© 1998-2020Legal notice