Dataset for CDS BCL-2 of organism Piliocolobus tephrosceles

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9HUK6_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A8C9HUK6_BCL2-02      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
                        **************************************************

A0A8C9HUK6_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtgggatgccgggg
A0A8C9HUK6_BCL2-02      gtacatccactataagctgtcgcagaggggctacgagtgggatgccgggg
                        **************************************************

A0A8C9HUK6_BCL2-01      atgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcc
A0A8C9HUK6_BCL2-02      atgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcc
                        **************************************************

A0A8C9HUK6_BCL2-01      tcccagcccgggcacacgccccatcccgccgcgtcccgggacccggtcgc
A0A8C9HUK6_BCL2-02      tcccagcccgggcacacgccccatcccgccgcgtcccgggacccggtcgc
                        **************************************************

A0A8C9HUK6_BCL2-01      caggacctcgccgctgccgaccccggctgcccccgccgccgccgcggggc
A0A8C9HUK6_BCL2-02      caggacctcgccgctgccgaccccggctgcccccgccgccgccgcggggc
                        **************************************************

A0A8C9HUK6_BCL2-01      ctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
A0A8C9HUK6_BCL2-02      ctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
                        **************************************************

A0A8C9HUK6_BCL2-01      ggtgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccag
A0A8C9HUK6_BCL2-02      ggtgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccag
                        **************************************************

A0A8C9HUK6_BCL2-01      ccagctgcacctgacgcccttcaccgcgcgggggcgctttgccacggtgg
A0A8C9HUK6_BCL2-02      ccagctgcacctgacgcccttcaccgcgcgggggcgctttgccacggtgg
                        **************************************************

A0A8C9HUK6_BCL2-01      tggaggagctcttcagggacggggtgaactgggggaggattgtggccttc
A0A8C9HUK6_BCL2-02      tggaggagctcttcagggacggggtgaactgggggaggattgtggccttc
                        **************************************************

A0A8C9HUK6_BCL2-01      tttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtc
A0A8C9HUK6_BCL2-02      tttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtc
                        **************************************************

A0A8C9HUK6_BCL2-01      gcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggc
A0A8C9HUK6_BCL2-02      gcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggc
                        **************************************************

A0A8C9HUK6_BCL2-01      acctgcacacctggatccaggataacggaggctgggatgcctttgtggaa
A0A8C9HUK6_BCL2-02      acctgcacacctggatccaggataacggaggctggg--------------
                        ************************************              

A0A8C9HUK6_BCL2-01      ctgtacggccccagcatgc----ggcctctg---tttgatttctcctggc
A0A8C9HUK6_BCL2-02      -----------cagcaggccagaggccacggaaattcgttgccacttcac
                                   ***** **    **** * *   ** * *  * * *  *

A0A8C9HUK6_BCL2-01      tgtctctgaagactctgctca---gtttggccctggtgggagcttgcatc
A0A8C9HUK6_BCL2-02      agtatctcattgcatcattgagaggtttactcctgat---------cagc
                         ** *** *   *     * *   ****   **** *         ** *

A0A8C9HUK6_BCL2-01      accctgggtgcctatctgggc--------cacaagtga------------
A0A8C9HUK6_BCL2-02      accgaaagaccatttttggcctttaaaaataaagatgaaagtccaagagc
                        ***    *  * * * *** *         * *  ***            

A0A8C9HUK6_BCL2-01      -
A0A8C9HUK6_BCL2-02      c
                         

© 1998-2023Legal notice