Dataset for CDS BCL-2-like of organism Rhinolophus ferrumequinum

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A671DJP1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L10 (length=681 residues).
gtctgtgtccaattaagagaaagaaattgggtcaaggcggacgggttgcggtcgcgccctgcgcggctgctaaccgactc
cctggcgtactgcgcccggggacccagcactgccacgctgccaccgtccgcgcccaaggccgccgtgctgcgctccgtgg
ccgcccaggtacagaggcgttaccagctcgtctggtcctgctaccgcggatatcagggaaatcgcgtcgtgctagtggaa
caggtggcgcaggagattctccacgacggccgcgttcccaggtggggccatgtggtggcgcgtattagtttcgcggggac
gctgctggagaaaccgccgccaggccgcaggctgagactgaaggaatgcgaggccgacgtttcccgggactgccaaagcc
tcgtggccttgctgtgcgactggctcagcacgcgcttggctagaggtaccaggcggttgggtgagcggggccagggaacc
cgggagggcctggcggggcgggcatcccgggacgcgcccctgcgacgggcacccggcgacctagtggccccagtcccgtg
ggcacattcgtttcagcagcgctgggaggttgagtgtgaattccagctttctcctcttttggcggagtcaggctgggaga
aaccggcctctctagacggctctcttattaagcggttctga
>gnl|bcl2dbcds|A0A671DWB3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgagacagaagggtta
tgtttgtggagctgggcccggggagggcccagcagctgatccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccgtcgcaccttctctgatctggcggctcagttgcatgtgaccccgggctcagctcagcagcgcttcacc
caggtctctgatgaactcttccaagggggtcccaactggggccgccttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacacggc
tagctgactggatccacagcagtgggggctgggagctggaagcgattaaagcgcgagtcagggagatggaggaagaagct
gaaaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
tatgtctattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtagactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggctcagtcaaccgtgttaccatactctgtgacaaatttagtggccaccccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctgtttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccaagagcccgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggtttcaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacttcatggtattccccttactaa
>gnl|bcl2dbcds|A0A671DWB3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L2 (length=924 residues).
atggcggcggcggcggcggcggcgacagcggcagcgggggctgcgggcggtcggggctccgggccggggcggcgacgcca
tcttgtgcccggggccggtggggaggccggggagggggccccagggggcgcaggggactacgggaacggcctggagtctg
aggaactggagcctggggagttgctgctggagccggagcccgagcccgagcccgaagaggagcctccccggccccgcgcc
cccccgggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtgga
gagtgacccgggggacggcgccattgaggacccggagctggaagcgattaaagcgcgagtcagggagatggaggaagaag
ctgaaaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtg
attatgtctattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtagactatggtgcaacagcaga
agagctggaagcacactttcatggctgtggctcagtcaaccgtgttaccatactctgtgacaaatttagtggccacccca
aagggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctgtttagagga
agacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccaagagcccgata
ccgtgcccggaccaccaactacaacagttcccgctctcgattctacagtggtttcaacagcaggccccggggtcgcgtct
acaggggccgggctagagcgacttcatggtattccccttactaa
>gnl|bcl2dbcds|A0A671EYI9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtagttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgcatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagtcctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaagcactgagggaggcaggtgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggg
tcctgacgggcgtgactttggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A671FEY2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtcctcgggggcaacccccgcgccgggcatcttctcctcccagcccg
agcgcaccccggcgcccgccaggacctcgccgccgccgccgctggctgcccccgctgccgccgcagggcctgcgctcagc
cccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgccga
gatgtccagccagctgcatctgacgcccttcaccgcgaggggacgctttgctacggtggtggaggagcttttcagggacg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccaacatgcggcctctgttcgatttctcctggctgtctctgaaggcactgc
tcagtctggccctggtgggagcttgtatcaccctgggtgcctatttgggccacaagtga
>gnl|bcl2dbcds|A0A671FLY8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2A1 (length=738 residues).
atgccggctcaggagcccggttcctcctcagcccagctacgctcagaagtgcctgggagggaggctcctatcagtgatgt
aagcagaaattctaccggccccacatctcattgtgagtcacatcccgccaggcttggaactctagcttcagattttctca
gccccttcccggtgaacaagctcaagacgctgctctccagctggcagaagatgaccgactgtgagtttgggtacatccac
gcgctggcccaggactatctgacgtatgtcctgcaggtgccacagcctgggactggccccagcagaacctccagagtatt
gcaagatattgcctcttccgtccaaaaggaagtggaaaagaatttgaagccatgcttggacagcttcgatgtcatgtcca
tagatactgccaggacaatattcaaccaagtgatggaaaaggagtttgaagacggcgtcattaactggggaaggattgtg
accatattcgcatttgaaggtattctcatcaagaaactgcttcgggagcagatcaccccagatgtggatacttacaagga
catttcttactttgttgctgacttcataacggaacacacaggagaatggataaggcagaacggaggctgggaaaatggct
ttgtaaagaagtttggacccaaatctggctggctgacttttctggaagttacaggcaagatctgtgaaatgttctgtctt
ctgaagcaatactgttga
>gnl|bcl2dbcds|A0A671G0G2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=MCL-1 (length=1044 residues).
atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtggggggtccgggttaggggccggcagcggcgg
cagcgcctccccttcgggagagcggcttctggccgcggggaaggaggccaccgcccggcgagaggcagggggaggggaag
ccggtgcggtgattggcggaagcgccggcgcgagccccccggccactctcgcgccggacgcccggagggtcgcgcggccc
tcgcccattggcgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttcgcgccctccttccgcgcgtc
gccgcttaaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggaactggacgggtacgagccggagc
ctctcgggaagcggccggctgtcctgcccttgctagagcgggtcgaggaggccagtaatggacccggtatgagcggctca
ctgccctctacgccgccccccgcagaggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggta
ccttcgggagcaggcgaccggcgccaaggacgcgaagccaatgggcaggtctgcgtccgccagccgcaaggcgttagaca
cccttcggcgggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaa
aacgaagacgacgtcaaatctttgtctcgagtgatgattcacgtttttagtgacggagtaacaaactggggcaggattgt
gactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcag
aaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctggagaatgccagcaagacaa
gtgcacttcgaagcagaggagcaggacacaggaccaaaatcctggcccaagttgagttctgagcagtactgttgctcctg
ttga
>gnl|bcl2dbcds|A0A671G0G2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=MCL-1 (length=1059 residues).
atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtggggggtccgggttaggggccggcagcggcgg
cagcgcctccccttcgggagagcggcttctggccgcggggaaggaggccaccgcccggcgagaggcagggggaggggaag
ccggtgcggtgattggcggaagcgccggcgcgagccccccggccactctcgcgccggacgcccggagggtcgcgcggccc
tcgcccattggcgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttcgcgccctccttccgcgcgtc
gccgcttaaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggaactggacgggtacgagccggagc
ctctcgggaagcggccggctgtcctgcccttgctagagcgggtcgaggaggccagtaatggacccggtatgagcggctca
ctgccctctacgccgccccccgcagaggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggta
ccttcgggagcaggcgaccggcgccaaggacgcgaagccaatgggcaggtctgcgtccgccagccgcaaggcgttagaca
cccttcggcgggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaa
aacgaagacgacgtcaaatctttgtctcgagtgatgattcacgtttttagtgacggagtaacaaactggggcaggattgt
gactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcag
aaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttc
ttccacgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtcggagctggtct
ggcatatctaataagatag
>gnl|bcl2dbcds|A0A671G0G2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=MCL-1 (length=597 residues).
atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtggggggtccgggttaggggccggcagcggcgg
cagcgcctccccttcgggagagcggcttctggcgaccggcgccaaggacgcgaagccaatgggcaggtctgcgtccgcca
gccgcaaggcgttagacacccttcggcgggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgacgtcaaatctttgtctcgagtgatgattcacgtttttagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccacgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtcggagctggtctggcatatctaataagatag
© 1998-2020Legal notice