Dataset for CDS BCL-2-like of organism Rhinolophus ferrumequinum

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671FLY8_BCL2A1-      -----------atgccggctcaggagcccggttcc---------------
A0A671DJP1_BCL2L10      gtctgtgtccaattaagagaaagaaattgggtcaa--------ggcggac
A0A671EYI9_BCL2L1-      -----------atgtc----------tcag----a--------gcaac-c
A0A671DWB3_BCL2L2-      -----------atggcgaccccagcctcagcccca--------gacacac
A0A671DWB3_BCL2L2-      -----------atggcggcggcggcggcggcggcg--------acagcgg
A0A671FEY2_BCL2-01      -----------atggcg-----cacgctgggagaacagggtatgataacc
A0A671G0G2_MCL1-01      -----------atgctg-----ggcctcaaaagaa---------------
A0A671G0G2_MCL1-02      -----------atgctg-----ggcctcaaaagaa---------------
A0A671G0G2_MCL1-03      -----------atgctg-----ggcctcaaaagaa---------------
                                   **                                     

A0A671FLY8_BCL2A1-      --------tcctcagcccagctacgctcagaagtgcctgggagggaggct
A0A671DJP1_BCL2L10      gggttgcggtcgc-gccctgcgcggctgctaaccgactccctggcgtact
A0A671EYI9_BCL2L1-      gggagctggtagttgactttctctcctacaagctt--tcccagaaaggat
A0A671DWB3_BCL2L2-      gggctctagtggcagactttgtaggctataagctg--agacagaagggtt
A0A671DWB3_BCL2L2-      cagcgggggctgcgggcggtcggggctccgggccg--gggcggcgacgcc
A0A671FEY2_BCL2-01      gggagatagtgatgaagtacatccactataagctg--tcgcagaggggct
A0A671G0G2_MCL1-01      ---acgcagtaatcggactcaacctcta----ctg--t-----ggggggt
A0A671G0G2_MCL1-02      ---acgcagtaatcggactcaacctcta----ctg--t-----ggggggt
A0A671G0G2_MCL1-03      ---acgcagtaatcggactcaacctcta----ctg--t-----ggggggt
                                                 **                       

A0A671FLY8_BCL2A1-      cctatcagtgatgtaagcagaaattctaccggccccacatctcattgtga
A0A671DJP1_BCL2L10      gcgcccgg----ggacccagcactg-------------------------
A0A671EYI9_BCL2L1-      ac------------agctggagtcagtttagtga--------tgtggaag
A0A671DWB3_BCL2L2-      atgtttgt----ggagctgggcccg--gggaggg--------cccagcag
A0A671DWB3_BCL2L2-      at-cttgt----g--cccggggccggtggggagg--------ccggggag
A0A671FEY2_BCL2-01      acgagtgg----gatgccggagacgcgggcgccgcgtcc---tcggg---
A0A671G0G2_MCL1-01      ccgggtta----ggggccggcagcggcggcagcgcctccccttcgggaga
A0A671G0G2_MCL1-02      ccgggtta----ggggccggcagcggcggcagcgcctccccttcgggaga
A0A671G0G2_MCL1-03      ccgggtta----ggggccggcagcggcggcagcgcctccccttcgggaga
                                           *                              

A0A671FLY8_BCL2A1-      gtcacatcccgccagg----------------------------------
A0A671DJP1_BCL2L10      --------------------------------------------------
A0A671EYI9_BCL2L1-      a--------------g------------------aacagaactgaggccc
A0A671DWB3_BCL2L2-      ctgatcc-----gctg------------------caccaagccatgcggg
A0A671DWB3_BCL2L2-      ggggccccagggggcg------------------caggggactacgggaa
A0A671FEY2_BCL2-01      --------------------------------------------------
A0A671G0G2_MCL1-01      gcggcttctggccgcggggaaggaggccaccgcccggcgagaggcagggg
A0A671G0G2_MCL1-02      gcggcttctggccgcggggaaggaggccaccgcccggcgagaggcagggg
A0A671G0G2_MCL1-03      gcggcttct-----------------------------------------
                                                                          

A0A671FLY8_BCL2A1-      -----------------------------------------------ctt
A0A671DJP1_BCL2L10      --------------------------------------------------
A0A671EYI9_BCL2L1-      cagaagggactgcatcagaga---------------------------tg
A0A671DWB3_BCL2L2-      cagctggagatgagttcgagacccgcttccgtcgcaccttctctgatctg
A0A671DWB3_BCL2L2-      cggcctg----gagtctgag------------------------gaactg
A0A671FEY2_BCL2-01      -------------------------------------------------g
A0A671G0G2_MCL1-01      gaggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccg
A0A671G0G2_MCL1-02      gaggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccg
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671FLY8_BCL2A1-      ggaactctagcttcagattt----------tctcagccccttcccggtga
A0A671DJP1_BCL2L10      -------ccacgctg---------------ccaccgtccgcgccca----
A0A671EYI9_BCL2L1-      ga-------------------------gacccccagtgcca--tcaatgg
A0A671DWB3_BCL2L2-      gcggct---cagttgcatgt-------gaccccgggctc-agctcagcag
A0A671DWB3_BCL2L2-      gagcctggggagttgctgctggagccggagcccgagcccgagcccgaaga
A0A671FEY2_BCL2-01      gcaacccccgcgccgggcatct--------------tctcctcccag---
A0A671G0G2_MCL1-01      gccactctcgcgccggacgcccggagggtcgcgcggccctcgcccattgg
A0A671G0G2_MCL1-02      gccactctcgcgccggacgcccggagggtcgcgcggccctcgcccattgg
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671FLY8_BCL2A1-      a-----------caagctcaagacgctgct--------------------
A0A671DJP1_BCL2L10      --------------aggccgccgtgctgc---------------------
A0A671EYI9_BCL2L1-      c-------------aacccatcctggcacctggcggaca-----------
A0A671DWB3_BCL2L2-      c-------------gcttcacccaggtctctgatgaactcttccaagggg
A0A671DWB3_BCL2L2-      g-------------gagcctccccggcccc------gcgcccccccggga
A0A671FEY2_BCL2-01      ----------cccgagcgcaccccggcgcccgccagg-------------
A0A671G0G2_MCL1-01      cgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttcg
A0A671G0G2_MCL1-02      cgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttcg
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671FLY8_BCL2A1-      ---------------ctccagctggc------------agaagatgaccg
A0A671DJP1_BCL2L10      ---------------gctccgtggcc-------------------gccca
A0A671EYI9_BCL2L1-      ---------------gtcctgcgg-------tgaat--ggagc--cactg
A0A671DWB3_BCL2L2-      gtcccaactggggccgccttgtggccttctttgtctttggagctgcactg
A0A671DWB3_BCL2L2-      gctccgg--------gccctg-ggcc-----tggctcgggagc--ccccg
A0A671FEY2_BCL2-01      ---------------acctcgccgcc-----gccgccgctggctgccccc
A0A671G0G2_MCL1-01      cgccctccttccgc-gcgtcgccgct-----taaggagatggaagccccg
A0A671G0G2_MCL1-02      cgccctccttccgc-gcgtcgccgct-----taaggagatggaagccccg
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671FLY8_BCL2A1-      actgt---------------------------------------------
A0A671DJP1_BCL2L10      ggtac---------------------------------------------
A0A671EYI9_BCL2L1-      gccac---------------------------------------------
A0A671DWB3_BCL2L2-      tgtgctgagagtgtcaacaag-----------------------------
A0A671DWB3_BCL2L2-      gcagccaggag-------gag-----------------------------
A0A671FEY2_BCL2-01      gctgccgccgcag-------------------------------------
A0A671G0G2_MCL1-01      gccgccgacgccatcatgtcgcccgaagaggaactggacgggtacgagcc
A0A671G0G2_MCL1-02      gccgccgacgccatcatgtcgcccgaagaggaactggacgggtacgagcc
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671FLY8_BCL2A1-      ----------------gagtttgggtacatccacgcgctggcccaggac-
A0A671DJP1_BCL2L10      ---------agaggcgttaccagctcgtctggtcctgctaccgcgga---
A0A671EYI9_BCL2L1-      -----------agcagcagct--------------tgga-----------
A0A671DWB3_BCL2L2-      ----------gagatggagccacttgtgggacaagtgcaggagtggatgg
A0A671DWB3_BCL2L2-      ----------gaggaggagcc------gggactggtgga-gagtg-----
A0A671FEY2_BCL2-01      -----------------ggcctgcgctcagccccgtgc------------
A0A671G0G2_MCL1-01      ggagcctctcgggaagcggccggctgtcctgcccttgctagagcgggtcg
A0A671G0G2_MCL1-02      ggagcctctcgggaagcggccggctgtcctgcccttgctagagcgggtcg
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671FLY8_BCL2A1-      ----------------------tatctgacgt--------------atgt
A0A671DJP1_BCL2L10      ----------------------tatcagggaa------------------
A0A671EYI9_BCL2L1-      ----------------------tgcccgggag--------------gtga
A0A671DWB3_BCL2L2-      tggcc-----------------tacctggagacacggctagctgactgga
A0A671DWB3_BCL2L2-      -----------------------acccggggg-acgg-------------
A0A671FEY2_BCL2-01      ----------------------cacctgtggt---------ccacctgac
A0A671G0G2_MCL1-01      aggaggccagtaatggacccggtatgagcggc---------tcactgccc
A0A671G0G2_MCL1-02      aggaggccagtaatggacccggtatgagcggc---------tcactgccc
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671FLY8_BCL2A1-      cctgcaggtgccacagcctgggactggccccagcagaacctccag-----
A0A671DJP1_BCL2L10      atcgcgtcg------------------------------tgctagtggaa
A0A671EYI9_BCL2L1-      tcccca------------------tggcagcggtgaagcaagcactgagg
A0A671DWB3_BCL2L2-      tccacagcagtgggggctgggagctggaagcgattaaagcgcgagtcagg
A0A671DWB3_BCL2L2-      ----cgccattgaggacccggagctggaagcgattaaagcgcgagtcagg
A0A671FEY2_BCL2-01      cctgcgcca-----------------------------------------
A0A671G0G2_MCL1-01      tctacgccgccccccgcagaggaggaggaggaggacgagttgtaccggca
A0A671G0G2_MCL1-02      tctacgccgccccccgcagaggaggaggaggaggacgagttgtaccggca
A0A671G0G2_MCL1-03      --------------------------------------------------
                                                                          

A0A671FLY8_BCL2A1-      --agtattgcaagatatt----------------gcctcttccgtccaaa
A0A671DJP1_BCL2L10      caggtggcgcaggagatt---------------------------ctcca
A0A671EYI9_BCL2L1-      gaggcaggtgatgagttt--------------gaa---ctgaggtaccga
A0A671DWB3_BCL2L2-      gagatggaggaagaagct--------------gaaaagctaaaggagcta
A0A671DWB3_BCL2L2-      gagatggaggaagaagct--------------gaaaagctaaaggagcta
A0A671FEY2_BCL2-01      --ggccggcgatgacttctc---------------------ccgtcgcta
A0A671G0G2_MCL1-01      gtcgctggagattatctctcggtaccttcgggagcaggcgaccggcgcca
A0A671G0G2_MCL1-02      gtcgctggagattatctctcggtaccttcgggagcaggcgaccggcgcca
A0A671G0G2_MCL1-03      ------------------------------------ggcgaccggcgcca
                                                                         *

A0A671FLY8_BCL2A1-      aggaagtggaaaaga-atttgaagccatgcttggacagcttcgatgtcat
A0A671DJP1_BCL2L10      cgacggccgcgttcccaggtggggccatgt------ggtggc-gcgtatt
A0A671EYI9_BCL2L1-      cgggc-----------attcagcgacctgacatcccagctcc-acatcac
A0A671DWB3_BCL2L2-      cagaa-cgaggtagagaagcagatgaatatgagtccacctcc-aggcaat
A0A671DWB3_BCL2L2-      cagaa-cgaggtagagaagcagatgaatatgagtccacctcc-aggcaat
A0A671FEY2_BCL2-01      ccgccgcgacttcgccgag-------atgtccagccagctgc-a-----t
A0A671G0G2_MCL1-01      aggacgcgaagccaatgggcaggtctgcgtcc-gccagccgc-aaggcgt
A0A671G0G2_MCL1-02      aggacgcgaagccaatgggcaggtctgcgtcc-gccagccgc-aaggcgt
A0A671G0G2_MCL1-03      aggacgcgaagccaatgggcaggtctgcgtcc-gccagccgc-aaggcgt
                                                                 *        

A0A671FLY8_BCL2A1-      ----gtccatagatactgcc---------------------aggacaata
A0A671DJP1_BCL2L10      agtttcgcggggacgctgctggagaaaccgccgccaggccgcaggctgag
A0A671EYI9_BCL2L1-      -----cccagggac-------------------------agcatatcaga
A0A671DWB3_BCL2L2-      gctggcccagtgattatgtc-----------tattgaggagaagatggag
A0A671DWB3_BCL2L2-      gctggcccagtgattatgtc-----------tattgaggagaagatggag
A0A671FEY2_BCL2-01      ---------ctgacgccctt-----------caccgcg-aggggacgctt
A0A671G0G2_MCL1-01      ---------tagacaccctt-----------cggcgggttggggacggtg
A0A671G0G2_MCL1-02      ---------tagacaccctt-----------cggcgggttggggacggtg
A0A671G0G2_MCL1-03      ---------tagacaccctt-----------cggcgggttggggacggtg
                                   **                                     

A0A671FLY8_BCL2A1-      ttcaac--------------------------------------------
A0A671DJP1_BCL2L10      actgaag-------------------gaatgcga----------------
A0A671EYI9_BCL2L1-      gct-------------------ttgagcaggtag----------------
A0A671DWB3_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtagactatggtgcaacagc
A0A671DWB3_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtagactatggtgcaacagc
A0A671FEY2_BCL2-01      tgctacg-------------------------------------------
A0A671G0G2_MCL1-01      tgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggac
A0A671G0G2_MCL1-02      tgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggac
A0A671G0G2_MCL1-03      tgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggac
                                                                          

A0A671FLY8_BCL2A1-      ---------------------------------caagtgatggaaaagga
A0A671DJP1_BCL2L10      -----------------------------------------ggccgacgt
A0A671EYI9_BCL2L1-      ----------------------------------------tgaatgaact
A0A671DWB3_BCL2L2-      agaa--------------------------------gagctggaagcaca
A0A671DWB3_BCL2L2-      agaa--------------------------------gagctggaagcaca
A0A671FEY2_BCL2-01      ------------------------------------gtggtggaggagct
A0A671G0G2_MCL1-01      atcaaaaacgaagacgacgtcaaatctttgtctcgagtgatgattcacgt
A0A671G0G2_MCL1-02      atcaaaaacgaagacgacgtcaaatctttgtctcgagtgatgattcacgt
A0A671G0G2_MCL1-03      atcaaaaacgaagacgacgtcaaatctttgtctcgagtgatgattcacgt
                                                                 *        

A0A671FLY8_BCL2A1-      gtttgaagacgg------cgtcattaactggggaaggat----tgtgacc
A0A671DJP1_BCL2L10      ttcccgggactgcca---------aagcctcgtggccttgctgtgcgact
A0A671EYI9_BCL2L1-      cttccgggatgg------ggt---gaactggggtcgcat----tgtggcc
A0A671DWB3_BCL2L2-      ctttcatggctgtggctcagt---caaccgtgttaccatactctgtgaca
A0A671DWB3_BCL2L2-      ctttcatggctgtggctcagt---caaccgtgttaccatactctgtgaca
A0A671FEY2_BCL2-01      tttcagggacgg------ggt---gaactgggggaggat----tgtggcc
A0A671G0G2_MCL1-01      ttttagtgacgg------agtaacaaactggggcaggat----tgtgact
A0A671G0G2_MCL1-02      ttttagtgacgg------agtaacaaactggggcaggat----tgtgact
A0A671G0G2_MCL1-03      ttttagtgacgg------agtaacaaactggggcaggat----tgtgact
                         *     *   *             * *   *      *    ** * * 

A0A671FLY8_BCL2A1-      atatt-----cgcatttgaaggtattctcatcaagaaactg---cttcgg
A0A671DJP1_BCL2L10      ggctcagca-cgcgcttgg--ctagaggtaccaggcggttgggtgagcgg
A0A671EYI9_BCL2L1-      ttttt-----ctccttcgg------tggggcactgtgcgtgga-aagcgt
A0A671DWB3_BCL2L2-      aatttagtggccaccccaa------agggtttgcatatataga-gttctc
A0A671DWB3_BCL2L2-      aatttagtggccaccccaa------agggtttgcatatataga-gttctc
A0A671FEY2_BCL2-01      ttctt-----tgagttcgg------tggggtcatgtgtgtgga-gagcgt
A0A671G0G2_MCL1-01      cttat-----ttcttttggtgcctttgtggccaaacacttgaa-gagtat
A0A671G0G2_MCL1-02      cttat-----ttcttttggtgcctttgtggccaaacacttgaa-gagtat
A0A671G0G2_MCL1-03      cttat-----ttcttttggtgcctttgtggccaaacacttgaa-gagtat
                                                               *          

A0A671FLY8_BCL2A1-      gagcagatcaccccagatgtggatacttacaaggacatttcttactttgt
A0A671DJP1_BCL2L10      ggccagggaa---------------cccgggag---------ggcctggc
A0A671EYI9_BCL2L1-      agacaaggaga------tgcaggtattggtgagtcggattgcaacttgga
A0A671DWB3_BCL2L2-      agacaaagag---------------tcagtgag---------gacttccc
A0A671DWB3_BCL2L2-      agacaaagag---------------tcagtgag---------gacttccc
A0A671FEY2_BCL2-01      caaccgggaga----tgtcg--cccctggtggacaacatcgccctgtgga
A0A671G0G2_MCL1-01      aaaccaagaaagctgcatcgaaccattagcagaaagcatcac-----aga
A0A671G0G2_MCL1-02      aaaccaagaaagctgcatcgaaccattagcagaaagcatcac-----aga
A0A671G0G2_MCL1-03      aaaccaagaaagctgcatcgaaccattagcagaaagcatcac-----aga
                           *                                              

A0A671FLY8_BCL2A1-      tgctgacttcataacgga-----acacacaggagaatggataaggcagaa
A0A671DJP1_BCL2L10      ggggcgggcatcccgggacgcgcccctgcga-----------cgggcacc
A0A671EYI9_BCL2L1-      tggccacttac--ctgaacgaccacctagag--ccttggatccaggagaa
A0A671DWB3_BCL2L2-      tggc--cttag--atgagtccctgtttagaggaagacaaatcaaggtgat
A0A671DWB3_BCL2L2-      tggc--cttag--atgagtccctgtttagaggaagacaaatcaaggtgat
A0A671FEY2_BCL2-01      tgaccgagtac--ctgaaccggcacctgcac--acctggatccaggataa
A0A671G0G2_MCL1-01      tgttctcgtaaggacaaaacgagactggcta--gtc---------aaaca
A0A671G0G2_MCL1-02      tgttctcgtaaggacaaaacgagactggcta--gtc---------aaaca
A0A671G0G2_MCL1-03      tgttctcgtaaggacaaaacgagactggcta--gtc---------aaaca
                         *                                                

A0A671FLY8_BCL2A1-      cggaggctgggaaaatggctttgt--------------------------
A0A671DJP1_BCL2L10      cggcgacctag---tggccccagtcccgtgggcacatt-------cgttt
A0A671EYI9_BCL2L1-      cggcggctggg---acacttttgt------ggaactctacgggaacaatg
A0A671DWB3_BCL2L2-      c-----ccaaa---acgaaccaac------agacc----aggcatcagca
A0A671DWB3_BCL2L2-      c-----ccaaa---acgaaccaac------agacc----aggcatcagca
A0A671FEY2_BCL2-01      cggaggctggg---acgcctttgt------ggaactgt------ac----
A0A671G0G2_MCL1-01      aagaggctgga---gaatgccagcaagacaagtgcact------tcgaag
A0A671G0G2_MCL1-02      aagaggctggg---atgggtttgt------ggagttct------tccacg
A0A671G0G2_MCL1-03      aagaggctggg---atgggtttgt------ggagttct------tccacg
                              *                                           

A0A671FLY8_BCL2A1-      -----------------aaagaagtttggaccc-----------------
A0A671DJP1_BCL2L10      cagcagcg---------ctgggaggttgagtgtg----------------
A0A671EYI9_BCL2L1-      cagcag-----------ccgagagccgga---agggccaggagc------
A0A671DWB3_BCL2L2-      caacagaccggggtttcccaagagcccgataccgtgcccggaccaccaac
A0A671DWB3_BCL2L2-      caacagaccggggtttcccaagagcccgataccgtgcccggaccaccaac
A0A671FEY2_BCL2-01      ----ggcc---------ccaacatgcggcctctgttc-------------
A0A671G0G2_MCL1-01      cagaggag---------c-aggacacaggacc----a-------------
A0A671G0G2_MCL1-02      tagaggac---------ctagaaggcggcatc----a-------------
A0A671G0G2_MCL1-03      tagaggac---------ctagaaggcggcatc----a-------------
                                              *    *                      

A0A671FLY8_BCL2A1-      ------------------------------aaatctggctggctgacttt
A0A671DJP1_BCL2L10      ------------------------------aattccagctttctcctctt
A0A671EYI9_BCL2L1-      -------------------------------gcttcaaccgctgggtcct
A0A671DWB3_BCL2L2-      tacaacagttcccgctctcgattctacagtggtttcaacagcaggccccg
A0A671DWB3_BCL2L2-      tacaacagttcccgctctcgattctacagtggtttcaacagcaggccccg
A0A671FEY2_BCL2-01      ------------------------------gatttctcctggctgtctct
A0A671G0G2_MCL1-01      ------------------------------aaa------tcctggcc---
A0A671G0G2_MCL1-02      ------------------------------gaaatgtgctgctggctttt
A0A671G0G2_MCL1-03      ------------------------------gaaatgtgctgctggctttt
                                                                          

A0A671FLY8_BCL2A1-      tctggaagttac--aggcaagatctgtgaaatgttc------------tg
A0A671DJP1_BCL2L10      ttggcg---------gagtcaggctgggagaaaccggcctctctagacgg
A0A671EYI9_BCL2L1-      gacgggcgt------gactttggctggcgtggttct-------gctg-gg
A0A671DWB3_BCL2L2-      gggtcgcgtctacaggggccgggctagagcgacttc-------atgg-ta
A0A671DWB3_BCL2L2-      gggtcgcgtctacaggggccgggctagagcgacttc-------atgg-ta
A0A671FEY2_BCL2-01      gaag-gcactgctcagtctggccctggtgggagcttgtatcaccctg-gg
A0A671G0G2_MCL1-01      -caa-gt-----tgagttctgagcagta---------------ctgt-tg
A0A671G0G2_MCL1-02      gcag-gtgttgctggagtcggagctggt---------------ctgg-ca
A0A671G0G2_MCL1-03      gcag-gtgttgctggagtcggagctggt---------------ctgg-ca
                                               *                          

A0A671FLY8_BCL2A1-      tcttctgaagcaatactgttga
A0A671DJP1_BCL2L10      ctctcttattaagcggttctga
A0A671EYI9_BCL2L1-      ctcgctcttcagtcggaaatga
A0A671DWB3_BCL2L2-      ttcccctt---------actaa
A0A671DWB3_BCL2L2-      ttcccctt---------actaa
A0A671FEY2_BCL2-01      tgcctatttgggccacaagtga
A0A671G0G2_MCL1-01      ctcctgttga------------
A0A671G0G2_MCL1-02      tatctaataagatag-------
A0A671G0G2_MCL1-03      tatctaataagatag-------
                                              

© 1998-2020Legal notice