Dataset for CDS BCL2L1 of organism Lates calcarifer

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A4W6BQD5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataaagtataaactctctcagagaaactatccactcaaccacatgga
actcaatgagcctccaaacaggactgatgggggggaggcagggtcaagtgaggaagagcggatagcaacacacgccaacg
gaacttttaacagcacgagtcctgggacccctccagcgtccccactgcggcagcaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttgcgatatgcccgcgccttcagcgatctgcacaa
ccagctgcacatcacgccggccacagcttaccaaagcttcgagaacgtgatggatgaagtgttccgggacggcgtcaact
ggggccgcatcatagggctttttgcgttcggcggggcgctgtgtgtcgagtgtgtggagaaggagatgagtccactggtg
ggcaggatcgtggagtggatgacagtttacctggacaaccacattcagccctggatccagagtcaaggaggatgggagcg
ctttgcagaaatctttgggcaggatgcagcagcagagagcaggaggtcccaggagagcttcaagaagtggctgctggcgg
ggatgaccctggtgaccggggtcgtggtgggctcactgattgctcagaagcgcctgtga
>gnl|bcl2dbcds|A0A4W6EST2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L1 (length=666 residues).
atgtcgtacagcaacagagagctagtggagttctttataagctacaagctttctcagaggaaccacccaacctctctgct
gaggccagaggatgctggtggaaggactgagggagataagaccaactcagctgccagtaacggcttgctggtcaacagca
gggacaggtgtggtcagcagggggcgccatcgcccctgcgtggtggcatagaggctgtaaaggcagctcttagggactct
gctgacgagtttgaactgctcttcacccaagcgttcagtgacctttcctcgcagcttgacatcactcctgacacagccta
ccacagctttaagagtgtgatggatgaggtgttcaaggatggtgtcaactggggacgtatagtgggtctgtttgcctttg
ggggtgtactgtgtgtggaatgtgtcgagaagaatatgagtgagctggtttcccgcattgcagactggatgaccatgtac
ctggatgagcgcatcagtccgtggattcagagccaaggaggctgggactgctttgctgagatttttgggcaagacgcagc
tgcagaagcgaggagatctcgggagactatgaggagatggctgctagttggagtggcgctgctaacaggagtgctggtcg
gtgtcctcgtcgctaagaaacagtga
© 1998-2020Legal notice