Dataset for CDS BCL2L1 of organism Lates calcarifer

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W6BQD5_BCL2L1-      atgtctca---aaacagagaactggtggttttctacataaagtataaact
A0A4W6EST2_BCL2L1-      atgtcgtacagcaacagagagctagtggagttctttataagctacaagct
                        *****  *    ******** ** ****  ****  ****  ** ** **

A0A4W6BQD5_BCL2L1-      ctctcagagaaactatccactcaaccacatggaactcaatgagcctccaa
A0A4W6EST2_BCL2L1-      ttctcagaggaaccacccaacctctctgctgaggccagaggatgctggtg
                         ******** *** * ***  *   *   **   *   * **  **    

A0A4W6BQD5_BCL2L1-      acaggactgatgggggggaggcagggtcaagtgaggaagagcggatagca
A0A4W6EST2_BCL2L1-      gaaggactga-----gggagataagaccaact------cagctgccagta
                          ********     *****  * *  *** *       *** *  ** *

A0A4W6BQD5_BCL2L1-      acacacgccaacggaacttttaacagcacgagtcctgggacccctccagc
A0A4W6EST2_BCL2L1-      acg---gcttgctgg----tcaacagca--------ggga----------
                        **    **   * *     * *******        ****          

A0A4W6BQD5_BCL2L1-      gtccccactgcgg-cagcaacggttgccatcaacgacg------agcctg
A0A4W6EST2_BCL2L1-      ----caggtgtggtcagcagggggcgccatcgcccctgcgtggtggcata
                            *   ** ** *****  **  ******  *   *       ** * 

A0A4W6BQD5_BCL2L1-      gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttgcg
A0A4W6EST2_BCL2L1-      gaggctgtaaaggcagctcttagggactctgctgacgagtttgaactgct
                        ** ** ** ** *  ** **  ******* **  **********  *** 

A0A4W6BQD5_BCL2L1-      atatgcccgcgccttcagcgatctgcacaaccagctgcacatcacgccgg
A0A4W6EST2_BCL2L1-      cttcacccaagcgttcagtgacctttcctcgcagcttgacatcactcctg
                         *   ***  ** ***** ** **   *   *****  ******* ** *

A0A4W6BQD5_BCL2L1-      ccacagcttaccaaagcttcgagaacgtgatggatgaagtgttccgggac
A0A4W6EST2_BCL2L1-      acacagcctaccacagctttaagagtgtgatggatgaggtgttcaaggat
                         ****** ***** *****  ***  *********** ******  *** 

A0A4W6BQD5_BCL2L1-      ggcgtcaactggggccgcatcatagggctttttgcgttcggcggggcgct
A0A4W6EST2_BCL2L1-      ggtgtcaactggggacgtatagtgggtctgtttgcctttgggggtgtact
                        ** *********** ** **  * ** ** ***** ** ** ** *  **

A0A4W6BQD5_BCL2L1-      gtgtgtcgagtgtgtggagaaggagatgagtccactggtgggcaggatcg
A0A4W6EST2_BCL2L1-      gtgtgtggaatgtgtcgagaagaatatgagtgagctggtttcccgcattg
                        ****** ** ***** ****** * ******   *****   * * ** *

A0A4W6BQD5_BCL2L1-      tggagtggatgacagtttacctggacaaccacattcagccctggatccag
A0A4W6EST2_BCL2L1-      cagactggatgaccatgtacctggatgagcgcatcagtccgtggattcag
                          ** ********  * ********  * * ***    ** ***** ***

A0A4W6BQD5_BCL2L1-      agtcaaggaggatgggagcgctttgcagaaatctttgggcaggatgcagc
A0A4W6EST2_BCL2L1-      agccaaggaggctgggactgctttgctgagatttttgggcaagacgcagc
                        ** ******** *****  ******* ** ** ******** ** *****

A0A4W6BQD5_BCL2L1-      agcagagagcaggaggtcccaggagagcttcaagaagtggctgctggcgg
A0A4W6EST2_BCL2L1-      tgcagaagcgaggagatctcgggagactatgaggagatggctgctagttg
                         *****    ***** ** * *****   * * **  ******** *  *

A0A4W6BQD5_BCL2L1-      ggatgaccctggtgaccggggtcgtggtgggctcactgattgctcagaag
A0A4W6EST2_BCL2L1-      gagtggcgctgctaacaggagtgctggtcggtgtcctcgtcgctaagaaa
                        *  ** * *** * ** ** **  **** **    **  * *** **** 

A0A4W6BQD5_BCL2L1-      cgcctgtga
A0A4W6EST2_BCL2L1-      ca---gtga
                        *    ****

© 1998-2023Legal notice