Dataset for CDS BAX-like of Organism Canis lupus dingo

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0LGU0_BOK-01       atgga--ggtgctgcggcgctcctcggtcctcgccgcggagatcatggac
A0A8C0JQK7_BAK1-01      atggc---atccgggcaa-ggcccagggcctcccaggcgggagtgtggag
A0A8C0LPP9_BAX-01       atggacgggtccggggagcaacccag--------aggcggggg-------
                        ****     * * *       **  *         *  * *         

A0A8C0LGU0_BOK-01       gcctttgaccgctcgcccagcgacaag--gagctggtggcccagg---cc
A0A8C0JQK7_BAK1-01      aggctgccccgtct-tctacttctgag--gagcaggtagcccgggacacc
A0A8C0LPP9_BAX-01       ----------gccc-accagctctgagcagatcatgaagacaggggccct
                                  *     * *      **  ** *  *  * *  **   * 

A0A8C0LGU0_BOK-01       aaggcgctgggccgg------gagttcgtgcacgcgcggctgctgcgcgc
A0A8C0JQK7_BAK1-01      gaggaggttttccgcagctatgttttttaccgccatcggcaggagcagg-
A0A8C0LPP9_BAX-01       -------tttgcttcag----ggtttcatccaagatcgagcagggcgaa-
                               *   *         *  **    *     **      **    

A0A8C0LGU0_BOK-01       cggcctggcctggaccgcgcccgagcgcgccgctcccg------------
A0A8C0JQK7_BAK1-01      -----aggctgagggggcggctgtgccagctgacccagaaatggtcacct
A0A8C0LPP9_BAX-01       -----tggggggagagacacctg----agctgcccttggagcaggtg---
                              **         *  * *     ** *  *  *            

A0A8C0LGU0_BOK-01       ---cccccgggggccgcctggccgagg------tgtgcgcggtgctgctg
A0A8C0JQK7_BAK1-01      tgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgct
A0A8C0LPP9_BAX-01       ---ccccaggatgcatc--caccaagaagc---tgagcgaatgtctcaag
                           ***  *       *    **  *       ** *       **    

A0A8C0LGU0_BOK-01       cgcctgggggatgagctggagctgatccggcccagcgtctaccgcaacgt
A0A8C0JQK7_BAK1-01      atcattggggacgacatcaaccag---------------cgctatgactc
A0A8C0LPP9_BAX-01       cgcatcggagatg------aactg---------------gacagtaacat
                          * * ** ** *      * * *                 *    **  

A0A8C0LGU0_BOK-01       ggcgcgccagctgaacatctcc-------ctgcagtcc-gagagcgtggt
A0A8C0JQK7_BAK1-01      ggagttccaggccatgct-gcagcacctacagccgacagcagagaatgcc
A0A8C0LPP9_BAX-01       ggagttgcagaggatgatcgcag------ctgtggaca-cagactctccc
                        ** *   ***   *   *  *        * *  * *   ***   *   

A0A8C0LGU0_BOK-01       gactgacgccttcctggcggtggcatctcagatcttctctggaggca---
A0A8C0JQK7_BAK1-01      ta-tgagtacttcaccaagattgcctc---gagcctatttgagagcggca
A0A8C0LPP9_BAX-01       cg-tgaggtcttcttccgagtggcagctgagatgttttctgatggcaact
                           ***   ****       * **  *   **   * * **   **    

A0A8C0LGU0_BOK-01       tcacatggggcaaggtggtgtcgctgtactccgtggccgcagggctggcg
A0A8C0JQK7_BAK1-01      tcaactggggccgagtggtggctctcctgggctttggctaccgcctggcc
A0A8C0LPP9_BAX-01       tcaactggggccgggttgttgccctcttctactttgccagcaaactggtg
                        ***  ******   ** **  * **      * * * *      ****  

A0A8C0LGU0_BOK-01       gt--ggactgtgtgcggcag---gcccagcccgccctg---gtccacgcg
A0A8C0JQK7_BAK1-01      ct-----gcatgtctaccaa----cgcggcctgaccgg---cttcctggg
A0A8C0LPP9_BAX-01       ctcaaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatggg
                         *        ***    **     * *   * *  * *      *  * *

A0A8C0LGU0_BOK-01       ctcgtc----gactgcctcggggagt-------tcgtgcgcaagaccctg
A0A8C0JQK7_BAK1-01      ccaggt----gacccgcttcgtggccgacttcatgctgcatcattgcatt
A0A8C0LPP9_BAX-01       ctggacactggacttccttcgagagcggc----tgctg------------
                        *  *      ***   **  * *          *  **            

A0A8C0LGU0_BOK-01       gcgccctggctgcggaggcgcggaggatgga-------------------
A0A8C0JQK7_BAK1-01      gcccggtggatcgcgcagaggggtggctgggtggcagccctgaacttggg
A0A8C0LPP9_BAX-01       ---ggctggatccaggaccagggtggttggg-------------------
                              *** *   *      ** ** ***                    

A0A8C0LGU0_BOK-01       --ccgacgtcctcaagtgtgtggtgagcacggagcccggcttccgctcgc
A0A8C0JQK7_BAK1-01      aaacggccccatcctgaacgtgctgatagtgctgtctgtggttctgttgg
A0A8C0LPP9_BAX-01       --acggcctcctct----cctact----------------------ttgg
                           ** *  * **       *  *                      * * 

A0A8C0LGU0_BOK-01       actggctggtggccgcg--------------------------ctc----
A0A8C0JQK7_BAK1-01      gccagtttgtgcctacaggtctgggggaaaggagagagaagttcatgatt
A0A8C0LPP9_BAX-01       gaca-------cccacgtggc---------agacagtgaccatctt----
                                    *  *                           *      

A0A8C0LGU0_BOK-01       ---------------------tgcagcttcgg-ccgcttcctgaag--gc
A0A8C0JQK7_BAK1-01      aagccaaatgcagggagcggatgcagatggagcccgctgac--cagcccc
A0A8C0LPP9_BAX-01       ---------------------tgtggctggag--tgcttactgcgtcact
                                             **  * *   *   ***  *         

A0A8C0LGU0_BOK-01       cgccttcctcgtgctgctgccagagagatg--a
A0A8C0JQK7_BAK1-01      caccctctgagtgtgtctgaaaataaactgtaa
A0A8C0LPP9_BAX-01       caccatctgga------aaaagatgggctg--a
                        * ** **                     **  *

© 1998-2023Legal notice