Dataset for CDS BAX-like of Organism Canis lupus dingo

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C0JQK7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Canis lupus dingo GN=BAK1 (length=732 residues).
atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtcttctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgagggggcggctg
tgccagctgacccagaaatggtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcacctacagccgacagcagagaatgc
ctatgagtacttcaccaagattgcctcgagcctatttgagagcggcatcaactggggccgagtggtggctctcctgggct
ttggctaccgcctggccctgcatgtctaccaacgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgctgcatcattgcattgcccggtggatcgcgcagaggggtggctgggtggcagccctgaacttgggaaacggccc
catcctgaacgtgctgatagtgctgtctgtggttctgttgggccagtttgtgcctacaggtctgggggaaaggagagaga
agttcatgattaagccaaatgcagggagcggatgcagatggagcccgctgaccagcccccaccctctgagtgtgtctgaa
aataaactgtaa
>gnl|bcl2dbcds|A0A8C0LGU0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Canis lupus dingo GN=BOK (length=642 residues).
atggaggtgctgcggcgctcctcggtcctcgccgcggagatcatggacgcctttgaccgctcgcccagcgacaaggagct
ggtggcccaggccaaggcgctgggccgggagttcgtgcacgcgcggctgctgcgcgccggcctggcctggaccgcgcccg
agcgcgccgctcccgcccccgggggccgcctggccgaggtgtgcgcggtgctgctgcgcctgggggatgagctggagctg
atccggcccagcgtctaccgcaacgtggcgcgccagctgaacatctccctgcagtccgagagcgtggtgactgacgcctt
cctggcggtggcatctcagatcttctctggaggcatcacatggggcaaggtggtgtcgctgtactccgtggccgcagggc
tggcggtggactgtgtgcggcaggcccagcccgccctggtccacgcgctcgtcgactgcctcggggagttcgtgcgcaag
accctggcgccctggctgcggaggcgcggaggatggaccgacgtcctcaagtgtgtggtgagcacggagcccggcttccg
ctcgcactggctggtggccgcgctctgcagcttcggccgcttcctgaaggccgccttcctcgtgctgctgccagagagat
ga
>gnl|bcl2dbcds|A0A8C0LPP9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Canis lupus dingo GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctgcccttggagcaggtgccccaggatg
catccaccaagaagctgagcgaatgtctcaagcgcatcggagatgaactggacagtaacatggagttgcagaggatgatc
gcagctgtggacacagactctccccgtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactg
gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgcttactgcgtcactcaccat
ctggaaaaagatgggctga
© 1998-2023Legal notice