Dataset for CDS Unclassified of organism Tigriopus californicus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A553NR23_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Tigriopus californicus (length=879 residues).
atgccgccctacccccagcacgccctgttgcggatcgagcctgcctccgatggcgtagtctccagtcccaccccgcccca
cgggtccgcctccacctccgcctccgtctcgtcggcctggccaggcctggccttggcttgtgaagaggagagcacgcaaa
cggaaggggcctcctcctcggattggggatccatttcgtcggcggcctcgatgggcttggagggcagtggggaggggggc
ctcagttcggacgggggtgaagcctcctcctcttctgtcatggcacgcctctccaggggtgtggtggggcgactatttgc
gccggaacggcaagaccgctcgacccaaaccatgaaagaccctttgacgtcggagaccgagaaattggcctttgacattg
ttttcttcaccattggtcggcgcaccgccaaaaccagcgatgaaatcgtcctttgtctccggcggagcgtccaacaaatg
ctggataaccacgccctcgtcttcaacggaatggtctccagactcgacctcaactctaatagtgatctcaatcaaggctt
ccaagacttagccaacgtccttttctccaataacgaggtcacttggaacaaaatcatcgccttattcgcatttgccgctc
gattggccctgtattgtgatgaacaccatttcgaaaacaaaatgttcgacgtggcctctaacctaagccaatgtgctatc
gagcacctcaccccattcttgagacgacacggtggatgggccactctttgtcaagctttcccggccgagagtgactacga
gtcaaagatatggacatctcttgtgataacgggcctaggcttgaccatgtttgccacttttttggcttggcaaagatga
© 1998-2023Legal notice