Dataset for CDS BAX-like of Organism Cyanistes caeruleus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0VHY3_BOK-01       atggaggtgctgcgtcgttcctcagtctttgctgcagaggtgatggaggt
A0A8C0VA71_BAK1-01      atgg---------------cctcag-----------ggaatgagggggac
A0A8C0UCC0_BAX-01       --------------------------------------------gagga-
A0A8C0UCC0_BAX-02       atga---------------cactgg---------------tgggaaggac
                                                                       *  

A0A8C0VHY3_BOK-01       ttttgaca-------ggtctcccactgacaaagagcttgtgtcccaagcc
A0A8C0VA71_BAK1-01      cctccacaggcgcagggacaccgaggg-------------------agcc
A0A8C0UCC0_BAX-01       -------------------tcccagcg-------------------agac
A0A8C0UCC0_BAX-02       tt-------------gggctccaggtg-------------------ggac
                                            **    *                    * *

A0A8C0VHY3_BOK-01       aaggctctctgcagagactacataaactcgaggctgattcaggcgggtgt
A0A8C0VA71_BAK1-01      acgggagcgggctcagctcagaaggccgcgtggcaga--------ggagg
A0A8C0UCC0_BAX-01       acag---------------------------ggcaca--------gggag
A0A8C0UCC0_BAX-02       acag---------------------------ggaaag--------gggat
                        *  *                           **            **   

A0A8C0VHY3_BOK-01       cagctggagcaaacccgagtacaat---------------gccccagtgc
A0A8C0VA71_BAK1-01      ccgaggaggtgttccggagctacgtcttctaccgctaccggcaggagcgc
A0A8C0UCC0_BAX-01       gacttggggtgttgccgagctgggt-------------------gag-ac
A0A8C0UCC0_BAX-02       acacagagccacaggaggacacagt-------------------gagtac
                             *          *       *                    **  *

A0A8C0VHY3_BOK-01       ctgggggtaagctggccgaggtgtccaccatactg---------------
A0A8C0VA71_BAK1-01      gaggagc-gag-gggcagagctg-ccgccggacccggagattgagcaaat
A0A8C0UCC0_BAX-01       ccagccc------agcagccctg-acaccaaacgc---------------
A0A8C0UCC0_BAX-02       ccagagttctg-gggcagccctg-acaccaaacgc---------------
                           *          ** *   **  * **  **                 

A0A8C0VHY3_BOK-01       ---------------------ctacgacttgggg----atgagctggagt
A0A8C0VA71_BAK1-01      ccagcaggagctggagagcaccgggagccaggtggggcagcgcttggccc
A0A8C0UCC0_BAX-01       ---------------------------ctcagtg----agtgcctgcggc
A0A8C0UCC0_BAX-02       ---------------------------ctcagtg----agtgcctgcggc
                                                   *   * *    *     **    

A0A8C0VHY3_BOK-01       acattcgccccaatgtctaccggaatatcgcccgccagctgaacatctcg
A0A8C0VA71_BAK1-01      tcattggggatgacatctacaagaactatgatgacgagttccgcaccatg
A0A8C0UCC0_BAX-01       gcatcggcgacgagctcgacagcaac----atg--gagctgcagaggatg
A0A8C0UCC0_BAX-02       gcatcggcgacgagctcgacagcaac----atg--gagctgcagaggatg
                         ***  *     *  ** **   **           ** *    *    *

A0A8C0VHY3_BOK-01       ctgca--ctcagagactgtggtgtcagacgccttcctggc----------
A0A8C0VA71_BAK1-01      ctggagaccctgcagcccacccgcgacaatgcctacgagcacttcaccaa
A0A8C0UCC0_BAX-01       attga------gcaggtggggtgtgatgcccccaaaaagctgtttttccg
A0A8C0UCC0_BAX-02       attga------gcaggtggggtgtgatgcccccaaaaagctgtttttccg
                         *  *      *          *  *     *      **          

A0A8C0VHY3_BOK-01       agtggctgcacagatcttcactgcaggca---taacgtggggcaaggtgg
A0A8C0VA71_BAK1-01      aattgcctccagcctgttcgagagcggca---tcaactggggccgggtga
A0A8C0UCC0_BAX-01       tgtggccaaggagatgttcgccgatggcaccttcaactggggccgtgtgg
A0A8C0UCC0_BAX-02       tgtggccaaggagatgttcgccgatggcaccttcaactggggccgtgtgg
                          * **        * ***      ****   * *  ******   *** 

A0A8C0VHY3_BOK-01       tgtctctctacgcc--------------------------gtggcag--c
A0A8C0VA71_BAK1-01      tcgccctgctggccttcgggtaccgcatggccatgtacgtgtggcagcgc
A0A8C0UCC0_BAX-01       ttgccctgttctactttgcgt----------------------gcaaact
A0A8C0UCC0_BAX-02       ttgccctgttctactttgcgt----------------------gcaaact
                        *  * **      *                             ***    

A0A8C0VHY3_BOK-01       tgggctggcggtggactgcgtgcggcacgcgcagccagccatggttcaca
A0A8C0VA71_BAK1-01      ggcgtcagcggcttcctgcgc------cgcatcgcccacttcgtggctga
A0A8C0UCC0_BAX-01       ggtgctgaaggctctctgcac------caaggtcccggagctggtccaga
A0A8C0UCC0_BAX-02       ggtgctgaaggctctctgcac------caaggtcccggagctggtccaga
                         * *     **    ****        *      **      *   *  *

A0A8C0VHY3_BOK-01       ccatcgttg-actgcctgggagagtttgtccgcaagaccttggtgacatg
A0A8C0VA71_BAK1-01      ct-tcatgctgcagaacc--------------gcatcgcccgctggatcg
A0A8C0UCC0_BAX-01       ctatcctgc-gctggaccatggagtatgtccaggaacacgtgctggcctg
A0A8C0UCC0_BAX-02       ctatcctgc-gctggaccatggagtatgtccaggaacacgtgctggcctg
                        *  ** *    * *                    *   *  * **    *

A0A8C0VHY3_BOK-01       gctgaaaaggagaggaggctgggca-------------------------
A0A8C0VA71_BAK1-01      --cccag---cagggaggatgg----------------------------
A0A8C0UCC0_BAX-01       gatccaggcccagggcggatgg----------------------------
A0A8C0UCC0_BAX-02       gatccaggcccagggcggatgggtgaggcccctaaccccccaattcctca
                             *       ** ** ***                            

A0A8C0VHY3_BOK-01       --gacatcacaaaatgtgtggtgaatactgatcccagccttcg-------
A0A8C0VA71_BAK1-01      --gaaacaacaa----------gga--caggcaaca--ccaaaggaaaaa
A0A8C0UCC0_BAX-01       ---------gaa----------gggctcttgtccca--cttcggga----
A0A8C0UCC0_BAX-02       ggggcccaagaa----------gggctcttgtccca--cttcggga----
                                  **          *    *      **  *           

A0A8C0VHY3_BOK-01       -ctcccactggctcgtggctgctgtttgcagttttggtcact----tcct
A0A8C0VA71_BAK1-01      tccaccccagggcaggaacagc-----agggttctc--------tgccat
A0A8C0UCC0_BAX-01       -cccccacctggca-gaccatc-----accatcttcgccgctggtgtcct
A0A8C0UCC0_BAX-02       -cccccacctggca-gaccatc-----accatcttcgccgctggtgtcct
                         *  ** *  *       *  *         *  *            * *

A0A8C0VHY3_BOK-01       caaggccatcttcttcgtcctgctgcctgagagatga-----------
A0A8C0VA71_BAK1-01      caaatactc------------a------aggaagtga-----------
A0A8C0UCC0_BAX-01       cacggcctcgctgaccatctgg------aagatgtcgtag--------
A0A8C0UCC0_BAX-02       cacggcctcgctgaccatctgg------aagatgtcgtagactctcgg
                        **    *                       **  *             

© 1998-2023Legal notice