Dataset for CDS BAX-like of Organism Cyanistes caeruleus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C0UCC0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyanistes caeruleus GN=BAX (length=492 residues).
gaggatcccagcgagacacagggcacagggaggacttggggtgttgccgagctgggtgagacccagcccagcagccctga
caccaaacgcctcagtgagtgcctgcggcgcatcggcgacgagctcgacagcaacatggagctgcagaggatgattgagc
aggtggggtgtgatgcccccaaaaagctgtttttccgtgtggccaaggagatgttcgccgatggcaccttcaactggggc
cgtgtggttgccctgttctactttgcgtgcaaactggtgctgaaggctctctgcaccaaggtcccggagctggtccagac
tatcctgcgctggaccatggagtatgtccaggaacacgtgctggcctggatccaggcccagggcggatgggaagggctct
tgtcccacttcgggacccccacctggcagaccatcaccatcttcgccgctggtgtcctcacggcctcgctgaccatctgg
aagatgtcgtag
>gnl|bcl2dbcds|A0A8C0UCC0_BAX-02 BCL2-associated X gene OS=[Eukaryota] Cyanistes caeruleus GN=BAX (length=564 residues).
atgacactggtgggaaggacttgggctccaggtgggacacagggaaaggggatacacagagccacaggaggacacagtga
gtacccagagttctggggcagccctgacaccaaacgcctcagtgagtgcctgcggcgcatcggcgacgagctcgacagca
acatggagctgcagaggatgattgagcaggtggggtgtgatgcccccaaaaagctgtttttccgtgtggccaaggagatg
ttcgccgatggcaccttcaactggggccgtgtggttgccctgttctactttgcgtgcaaactggtgctgaaggctctctg
caccaaggtcccggagctggtccagactatcctgcgctggaccatggagtatgtccaggaacacgtgctggcctggatcc
aggcccagggcggatgggtgaggcccctaaccccccaattcctcaggggcccaagaagggctcttgtcccacttcgggac
ccccacctggcagaccatcaccatcttcgccgctggtgtcctcacggcctcgctgaccatctggaagatgtcgtagactc
tcgg
>gnl|bcl2dbcds|A0A8C0VA71_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Cyanistes caeruleus GN=BAK1 (length=627 residues).
atggcctcagggaatgagggggaccctccacaggcgcagggacaccgagggagccacgggagcgggctcagctcagaagg
ccgcgtggcagaggaggccgaggaggtgttccggagctacgtcttctaccgctaccggcaggagcgcgaggagcgagggg
cagagctgccgccggacccggagattgagcaaatccagcaggagctggagagcaccgggagccaggtggggcagcgcttg
gccctcattggggatgacatctacaagaactatgatgacgagttccgcaccatgctggagaccctgcagcccacccgcga
caatgcctacgagcacttcaccaaaattgcctccagcctgttcgagagcggcatcaactggggccgggtgatcgccctgc
tggccttcgggtaccgcatggccatgtacgtgtggcagcgcggcgtcagcggcttcctgcgccgcatcgcccacttcgtg
gctgacttcatgctgcagaaccgcatcgcccgctggatcgcccagcagggaggatgggaaacaacaaggacaggcaacac
caaaggaaaaatccaccccagggcaggaacagcagggttctctgccatcaaatactcaaggaagtga
>gnl|bcl2dbcds|A0A8C0VHY3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Cyanistes caeruleus GN=BOK (length=642 residues).
atggaggtgctgcgtcgttcctcagtctttgctgcagaggtgatggaggtttttgacaggtctcccactgacaaagagct
tgtgtcccaagccaaggctctctgcagagactacataaactcgaggctgattcaggcgggtgtcagctggagcaaacccg
agtacaatgccccagtgcctgggggtaagctggccgaggtgtccaccatactgctacgacttggggatgagctggagtac
attcgccccaatgtctaccggaatatcgcccgccagctgaacatctcgctgcactcagagactgtggtgtcagacgcctt
cctggcagtggctgcacagatcttcactgcaggcataacgtggggcaaggtggtgtctctctacgccgtggcagctgggc
tggcggtggactgcgtgcggcacgcgcagccagccatggttcacaccatcgttgactgcctgggagagtttgtccgcaag
accttggtgacatggctgaaaaggagaggaggctgggcagacatcacaaaatgtgtggtgaatactgatcccagccttcg
ctcccactggctcgtggctgctgtttgcagttttggtcacttcctcaaggccatcttcttcgtcctgctgcctgagagat
ga
© 1998-2023Legal notice